RIC3 (NM_001206672) Human Untagged Clone
CAT#: SC331670
RIC3 (untagged) - Homo sapiens RIC3 acetylcholine receptor chaperone (RIC3), transcript variant 4
"NM_001206672" in other vectors (2)
Product Images
Other products for "RIC3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RIC3 |
Synonyms | AYST720; PRO1385 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001206672, the custom clone sequence may differ by one or more nucleotides
ATGGCGTACTCCACAGTGCAGAGAGTCGCTCTGGCTTCTGGGCTTGTCCTGGCTCTGTCGCTGCTGCTGC CCAAGGCCTTCCTGTCCCGCGGGAAGCGGCAGGAGCCGCCGCCGACACCTGAAGGAAAATTGGGCCGATT TCCACCTATGATGCATCATCACCAGGCACCCTCAGATGGCCAGACTCCTGGGGCTCGTTTCCAGAGGTCT CACCTTGCCGAGGCATTTGCAAAGGCCAAAGGATCAGGTGGAGGTGCTGGAGGAGGAGGTAGTGGAAGAG GTCTGATGGGGCAGATTATTCCAATCTACGGTTTTGGGATTTTTTTATATATACTGTACATTCTATTTAA GCTCTCAAAGGGGAAAACAACTGCAGAGGATGGGAAATGCTATACTGCCATGCCTGGAAACACCCACAGG AAAATTAGTTACCCTGAAGAGACTTACCCAATTTATGACCTTTCAGACTGTATCAAGCGTAGGCAAGAAA CAATCTTGGTGGATTACCCTGACCCAAAAGAACTTTCTGCTGAAGAAATAGCTGAAAGAATGGGAATGAT AGAAGAGGAAGAATCAGATCATTTGGGTTGGGAAAGTCTGCCCACTGACCCCAGAGCCCAGGAAGATAAT TCTGTTACCTCGTGTGATCCAAAGCCAGAAACATGTTCCTGCTGTTTTCATGAAGACGAGGATCCTGCTG TCTTGGCAGAGAATGCTGGATTCAGTGCAGATAGCTACCCTGAGCAAGAGGAAACCACCAAAGAAGAGTG GTCCCAAGACTTTAAAGATGAAGGGTTGGGCATCAGCACCGATAAAGCATATACAGGCAGCATGCTGAGG AAGCGTAACCCCCAGGGTTTAGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206672 |
ORF Size | 867 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001206672.2, NP_001193601.1 |
RefSeq Size | 5587 |
RefSeq ORF | 867 |
Locus ID | 79608 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (4) lacks two consecutive exons in the coding region, compared to variant 1. The encoded isoform (e) is shorter than isoform c. The isoform designation was changed from 'd' to 'e' to be consistent with isoforms cited in PMID 18691158. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.