CDHH (CDH13) (NM_001220490) Human Untagged Clone

CAT#: SC331767

CDH13 (untagged) - Homo sapiens cadherin 13 (CDH13), transcript variant 4


  "NM_001220490" in other vectors (2)

Reconstitution Protocol

USD 460.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDH13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDH13
Synonyms CDHH; P105
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001220490, the custom clone sequence may differ by one or more nucleotides


ATGGAAGGGTCACCCACAGGCACCACAGTGATGCGGATGACAGCCTTTGATGCAGATGACCCAGCCACCG
ATAATGCCCTCCTGCGGTATAATATCCGTCAGCAGACGCCTGACAAGCCATCTCCCAACATGTTCTACAT
CGATCCTGAGAAAGGAGACATTGTCACTGTTGTGTCACCTGCGCTGCTGGACCGAGAGACTCTGGAAAAT
CCCAAGTATGAACTGATCATCGAGGCTCAAGATATGGCTGGACTGGATGTTGGATTAACAGGCACGGCCA
CAGCCACGATCATGATCGATGACAAAAATGATCACTCACCAAAATTCACCAAGAAAGAGTTTCAAGCCAC
AGTCGAGGAAGGAGCTGTGGGAGTTATTGTCAATTTGACAGTTGAAGATAAGGATGACCCCACCACAGGT
GCATGGAGGGCTGCCTACACCATCATCAACGGAAACCCCGGGCAGAGCTTTGAAATCCACACCAACCCTC
AAACCAACGAAGGGATGCTTTCTGTTGTCAAACCATTGGACTATGAAATTTCTGCCTTCCACACCCTGCT
GATCAAAGTGGAAAATGAAGACCCACTCGTACCCGACGTCTCCTACGGCCCCAGCTCCACAGCCACCGTC
CACATCACTGTCCTGGATGTCAACGAGGGCCCAGTCTTCTACCCAGACCCCATGATGGTGACCAGGCAGG
AGGACCTCTCTGTGGGCAGCGTGCTGCTGACAGTGAATGCCACGGACCCCGACTCCCTGCAGCATCAAAC
CATCAGGTATTCTGTTTACAAGGACCCAGCAGGTTGGCTGAATATTAACCCCATCAATGGGACTGTTGAC
ACCACAGCTGTGCTGGACCGTGAGTCCCCATTTGTCGACAACAGCGTGTACACTGCTCTCTTCCTGGCAA
TTGACAGTGGCAACCCTCCCGCTACGGGCACTGGGACTTTGCTGATAACCCTGGAGGACGTGAATGACAA
TGCCCCGTTCATTTACCCCACAGTAGCTGAAGTCTGTGATGATGCCAAAAACCTCAGTGTAGTCATTTTG
GGAGCATCAGATAAGGATCTTCACCCGAATACAGATCCTTTCAAATTTGAAATCCACAAACAAGCTGTTC
CTGATAAAGTCTGGAAGATCTCCAAGATCAACAATACACACGCCCTGGTAAGCCTTCTTCAAAATCTGAA
CAAAGCAAACTACAACCTGCCCATCATGGTGACAGATTCAGGGAAACCACCCATGACGAATATCACAGAT
CTCAGGGTACAAGTGTGCTCCTGCAGGAATTCCAAAGTGGACTGCAACGCGGCAGGGGCCCTGCGCTTCA
GCCTGCCCTCAGTCCTGCTCCTCAGCCTCTTCAGCTTAGCTTGTCTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001220490
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001220490.1, NP_001207419.1
RefSeq Size 3819 bp
RefSeq ORF 1380 bp
Locus ID 1012
Cytogenetics 16q23.3
Gene Summary 'This gene encodes a member of the cadherin superfamily. The encoded protein is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. The protein lacks the cytoplasmic domain characteristic of other cadherins, and so is not thought to be a cell-cell adhesion glycoprotein. This protein acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. The gene is hypermethylated in many types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2011]'
Transcript Variant: This variant (4) lacks an exon in the coding region resulting in use of a downstream start codon, compared to variant 1. It encodes isoform 4, which is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.