CD23 (FCER2) (NM_001220500) Human Untagged Clone

CAT#: SC331769

FCER2 (untagged) - Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23) (FCER2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FCER2
• Synonyms: BLAST-2; CD23; CD23A; CLEC4J; FCE2; IGEBF
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001220500, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGAAGGTCAATATTCAGAGATCGAGGAGCTTCCCAGGAGGCGGTGTTGCAGGCGTGGGACTCAGA
  TCGTGCTGCTGGGGCTGGTGACCGCCGCTCTGTGGGCTGGGCTGCTGACTCTGCTTCTCCTGTGGCACTG
  GGACACCACACAGAGTCTAAAACAGCTGGAAGAGAGGGCTGCCCGGAACGTCTCTCAAGTTTCCAAGAAC
  TTGGAAAGCCACCACGGTGACCAGATGGCGCAGAAATCCCAGTCCACGCAGATTTCACAGGAACTGGAGG
  AACTTCGAGCTGAACAGCAGAGATTGAAATCTCAGGACTTGGAGCTGTCCTGGAACCTGAACGGGCTTCA
  AGCAGATCTGAGCAGCTTCAAGTCCCAGGAATTGAACGAGAGGAACGAAGCTTCAGATTTGCTGGAAAGA
  CTCCGGGAGGAGGTGACAAAGCTAAGGATGGAGTTGCAGGTGTCCAGCGGCTTTGTGTGCAACACGTGCC
  CTGAAAAGTGGATCAATTTCCAACGGAAGTGCTACTACTTCGGCAAGGGCACCAAGCAGTGGGTCCACGC
  CCGGTATGCCTGTGACGACATGGAAGGGCAGCTGGTCAGCATCCACAGCCCGGAGGAGCAGGACTTCCTG
  ACCAAGCATGCCAGCCACACCGGCTCCTGGATTGGCCTTCGGAACTTGGACCTGAAGGGGGAGTTTATCT
  GGGTGGATGGGAGCCACGTGGACTACAGCAACTGGGCTCCAGGGGAGCCCACCAGCCGGAGCCAGGGCGA
  GGACTGCGTGATGATGCGGGGCTCCGGTCGCTGGAACGACGCCTTCTGCGACCGTAAGCTGGGCGCCTGG
  GTGTGCGACCGGCTGGCCACATGCACGCCGCCAGCCAGCGAAGGTTCCGCGGAGTCCATGGGACCTGATT
  CAAGACCAGACCCTGACGGCCGCCTGCCCACCCCCTCTGCCCCTCTCCACTCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001220500
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001220500.1, NP_001207429.1
• RefSeq Size: 1624 bp
• RefSeq ORF: 966 bp
• Locus ID: 2208
• Cytogenetics: 19p13.2
• Protein Families: Secreted Protein, Transmembrane
• Protein Pathways: Hematopoietic cell lineage
• Gene Summary: 'The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]'
  Transcript Variant: This variant (3) uses an alternate donor splice site in the 5' UTR, compared to variant 1. Both variants 1 and 3 encode the same isoform (a, also known as CD23a).