DARPP32 (PPP1R1B) (NM_001242464) Human Untagged Clone

CAT#: SC331806

PPP1R1B (untagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1B (PPP1R1B), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP1R1B
• Synonyms: DARPP-32; DARPP32
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242464, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGTTCCGGCTCTCAGAGCACTCCTCACCAGAGGAGGAAGCCTCCCCCCACCAGAGAGCCTCAGGAG
  AGGGGCACCATCTCAAGTCGAAGAGACCCAACCCCTGTGCCTACACACCACCTTCGCTGAAAGCTGTGCA
  GCGCATTGCTGAGTCTCACCTGCAGTCTATCAGCAATTTGAATGAGAACCAGGCCTCAGAGGAGGAGGAT
  GAGCTGGGGGAGCTTCGGGAGCTGGGTTATCCAAGAGAGGAAGATGAGGAGGAAGAGGAGGATGATGAAG
  AAGAGGAAGAAGAAGAGGACAGCCAGGCTGAAGTCCTGAAGGTCATCAGGCAGTCTGCTGGGCAAAAGAC
  AACCTGTGGCCAGGGTCTGGAAGGGCCCTGGGAGCGCCCACCCCCTCTGGATGAGTCCGAGAGAGATGGA
  GGCTCTGAGGACCAAGTGGAAGACCCAGCACTAAGTGAGCCTGGGGAGGAACCTCAGCGCCCTTCCCCCT
  CTGAGCCTGGCACATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242464
• ORF Size: 507 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001242464.1, NP_001229393.1
• RefSeq Size: 1446
• RefSeq ORF: 507
• Locus ID: 84152
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a bifunctional signal transduction molecule. Dopaminergic and glutamatergic receptor stimulation regulates its phosphorylation and function as a kinase or phosphatase inhibitor. As a target for dopamine, this gene may serve as a therapeutic target for neurologic and psychiatric disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Variants 2 and 3 encode isoform 2.