BRCC36 (BRCC3) (NM_001242640) Human Untagged Clone

CAT#: SC331836

BRCC3 (untagged) - Homo sapiens BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BRCC3
• Synonyms: BRCC36; C6.1A; CXorf53
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242640, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGTGCAGGTGGTGCAGGCGGTGCAGGCGGTTCATCTCGAGTCTGACGCTTTCCTCGTTTGTCTCA
  ACCACGCTCTGAGCACAGAGAAGGAGGAAGTAATGGGGCTGTGCATAGGGGAGTTGAACGATGATACAAG
  TAGGAGTGACTCCAAATTTGCATATACTGGAACTGAAATGCGCACAGTTGCTGAAAAGGTTGATGCCGTC
  AGAATTGTTCACATTCATTCTGTCATCATCTTACGACGTTCTGATAAGAGGAAGGACCGAGTAGAAATTT
  CTCCAGAGCAGCTGTCTGCAGCTTCAACAGAGGCAGAGAGGTTGGCTGAACTGACAGGCCGCCCCATGAG
  AGTTGTGGGCTGGTATCATTCCCATCCTCATATAACTGTTTGGCCTTCACATGTTGATGTTCGCACACAA
  GCCATGTACCAGATGATGGATCAAGGCTTTGTAGGACTTATTTTTTCCTGTTTCATAGAAGATAAGAACA
  CAAAGACTGGCCGGGTACTCTACACTTGCTTCCAATCCATACAGGCCCAAAAGAGTTCAGAGTATGAGAG
  AATCGAAATCCCAATCCATATTGTACCTCATGTCACTATCGGGAAAGTGTGCCTTGAATCAGCAGTAGAG
  CTGCCCAAGATCCTGTGCCAGGAGGAGCAGGATGCGTATAGGAGGATCCACAGCCTTACACATCTGGACT
  CAGTAACCAAGATCCATAATGGCTCAGTGTTTACCAAGAATCTGTGCAGTCAGATGTCGGCAGTCAGCGG
  GCCTCTCCTACAGTGGTTGGAGGACAGACTGGAGCAAAACCAACAGCATTTGCAGGAATTACAACAAGAA
  AAGGAAGAGCTTATGCAAGAACTTTCTTCTCTAGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242640
• ORF Size: 879 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001242640.1, NP_001229569.1
• RefSeq Size: 2880
• RefSeq ORF: 879
• Locus ID: 79184
• Protein Families: Druggable Genome, Protease
• Gene Summary: This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jun 2011]
  Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 5' coding region, and lacks an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.