PRMT2 (NM_001242865) Human Untagged Clone

CAT#: SC331907

PRMT2 (untagged) - Homo sapiens protein arginine methyltransferase 2 (PRMT2), transcript variant 4


  "NM_001242865" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRMT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRMT2
Synonyms HRMT1L1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001242865, the custom clone sequence may differ by one or more nucleotides


ATGGCAACATCAGGTGACTGTCCCAGAAGTGAATCGCAGGGAGAAGAGCCTGCTGAGTGCAGTGAGGCCG
GTCTCCTGCAGGAGGGAGTACAGCCAGAGGAGTTTGTGGCCATCGCGGACTACGCTGCCACCGATGAGAC
CCAGCTCAGTTTTTTGAGAGGAGAAAAAATTCTTATCCTGAGACAAACCACTGCAGATTGGTGGTGGGGT
GAGCGTGCGGGCTGCTGTGGGTACATTCCGGCAAACCATGTGGGGAAGCACGTGGATGAGTACGACCCCG
AGGACACGTGGCAGGATGAAGAGTACTTCGGCAGCTATGGAACTCTGAAACTCCACTTGGAGATGTTGGC
AGACCAGCCACGAACAACTAAATACCACAGTGTCATCCTGCAGAATAAAGAATCCCTGACGGATAAAGTC
ATCCTGGACGTGGGCTGTGGGACTGGGATCATCAGTCTCTTCTGTGCACACTATGCGCGGCCTAGAGCGG
TGTACGCGGTGGAGGCCAGTGAGATGGCACAGCACACGGGGCAGCTGGTCCTGCAGAACGGCTTTGCTGA
CATCATCACCGTGTACCAGCAGAAGGTGGAGGATGTGGTGCTGCCCGAGAAGGTGGACGTGCTGGTGTCT
GAGTGGATGGGGACCTGCCTGCTGGCTGCGCCTCTCCTGAGCTGCCGCATTCTCCCCTGCACCTGTGCGT
CTGGCCCTCTTCACGTCCTCCTGGCCTGCTGTCTGCCTCTCCCCTGCACCTGTGCGTCTGTCCCTCTTCA
TGTCCTCCTTGCCTGCTGTCTGCCTGTTCTCAGAGCCCCTCAGCCCTCAGGCCTTCATCTCTCCTGGCCC
ATCTTCCTACTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001242865
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242865.2, NP_001229794.1
RefSeq Size 4171 bp
RefSeq ORF 855 bp
Locus ID 3275
Cytogenetics 21q22.3
Protein Families Druggable Genome
Gene Summary ''
Transcript Variant: This variant (4) differs in the 5' UTR and has an alternate 3' terminal exon that causes a frame-shift compared to variant 1. The resulting shorter isoform (3) has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.