KIR3DL2 (NM_001242867) Human Untagged Clone
CAT#: SC331908
KIR3DL2 (untagged) - Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), transcript variant 2
"NM_001242867" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KIR3DL2 |
Synonyms | 3DL2; CD158K; KIR-3DL2; NKAT-4; NKAT4; NKAT4B; p140 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001242867, the custom clone sequence may differ by one or more nucleotides
ATGTCGCTCACGGTCGTCAGCATGGCGTGCGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACTCATGG GTGGTCAGGACAAACCCTTCCTGTCTGCCCGGCCCAGCACTGTGGTGCCTCGAGGAGGACACGTGGCTCT TCAGTGTCACTATCGTCGTGGGTTTAACAATTTCATGCTGTACAAAGAAGACAGAAGCCACGTTCCCATC TTCCACGGCAGAATATTCCAGGAGAGCTTCATCATGGGCCCTGTGACCCCAGCACATGCAGGGACCTACA GATGTCGGGGTTCACGCCCACACTCCCTCACTGGGTGGTCGGCACCCAGCAACCCCCTGGTGATCATGGT CACAGGAAACCACAGAAAACCTTCCCTCCTGGCCCACCCAGGGCCCCTGCTGAAATCAGGAGAGACAGTC ATCCTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCTTTCTGCACAGAGAGGGGATCTCTGAGGACC CCTCACGCCTCGTTGGACAGATCCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCCCTTGATGCC TGTCCTTGCAGGAACCTACAGATGTTATGGTTCTGTTCCTCACTCCCCCTATCAGTTGTCAGCTCCCAGT GACCCCCTGGACATCGTGATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGG TTCAGGCAGGAGAGAACGTGACCTTGTCCTGTAGCTCCTGGAGCTCCTATGACATCTACCATCTGTCCAG GGAAGGGGAGGCCCATGAACGTAGGCTCCGTGCAGTGCCCAAGGTCAACAGAACATTCCAGGCAGACTTT CCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGCCCTGCCCTGCGTGT GGTCAAACTCAAGTGACCCACTGCTTGTTTCTGTCACAGGTATCTGCAGACACCTGCATGTTCTGATTGG GACCTCAGTGGTCATCTTCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTTATCGCTGGTGCTCCAACAAA AAGAATGCTGCTGTAATGGACCAAGAGCCTGCGGGGGACAGAACAGTGAATAGGCAGGACTCTGATGAAC AAGACCCTCAGGAGGTGACGTACGCACAGTTGGATCACTGCGTTTTCATACAGAGAAAAATCAGTCGCCC TTCTCAGAGGCCCAAGACACCCCTAACAGATACCAGCGTGTACACGGAACTTCCAAATGCTGAGCCCAGA TCCAAAGTTGTCTCCTGCCCACGAGCACCACAGTCAGGTCTTGAGGGGGTTTTCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242867 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242867.1, NP_001229796.1 |
RefSeq Size | 1834 bp |
RefSeq ORF | 1317 bp |
Locus ID | 3812 |
Cytogenetics | 19q13.42 |
Protein Families | Transmembrane |
Protein Pathways | Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity |
Gene Summary | 'Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the "framework" loci that is present on all haplotypes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]' Transcript Variant: This variant (2) lacks an exon in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC234094 | KIR3DL2 (Myc-DDK tagged) - Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), transcript variant 2 |
USD 460.00 |
|
RG234094 | KIR3DL2 (GFP-tagged) - Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), transcript variant 2 |
USD 510.00 |
{0} Product Review(s)
Be the first one to submit a review