HLAC (HLA-C) (NM_001243042) Human Untagged Clone

CAT#: SC331942

HLA (untagged) - Homo sapiens major histocompatibility complex, class I, C (HLA-C), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HLA-C
• Synonyms: D6S204; HLA-JY3; HLAC; HLC-C; MHC; PSORS1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243042, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGGTCATGGCGCCCCGAGCCCTCCTCCTGCTGCTCTCGGGAGGCCTGGCCCTGACCGAGACCTGGG
  CCTGCTCCCACTCCATGAGGTATTTCGACACCGCCGTGTCCCGGCCCGGCCGCGGAGAGCCCCGCTTCAT
  CTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAG
  CCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAACTACAAGCGCC
  AGGCACAGGCTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGACGGGTCTCA
  CACCCTCCAGAGGATGTATGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTCC
  GCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGG
  CTCAGATCACCCAGCGCAAGTTGGAGGCGGCCCGTGCGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCAC
  GTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCAGAACCCCCAAAG
  ACACACGTGACCCACCACCCCCTCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACC
  CTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACCGAGCTTGTGGAGAC
  CAGGCCAGCAGGAGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGACAAGAGCAGAGA
  TACACGTGCCATATGCAGCACGAGGGGCTGCAAGAGCCCCTCACCCTGAGCTGGGAGCCATCTTCCCAGC
  CCACCATCCCCATCATGGGCATCGTTGCTGGCCTGGCTGTCCTGGTTGTCCTAGCTGTCCTTGGAGCTGT
  GGTCACCGCTATGATGTGTAGGAGGAAGAGCTCAGGTGGAAAAGGAGGGAGCTGCTCTCAGGCTGCGTGC
  AGCAACAGTGCCCAGGGCTCTGATGAGTCTCTCATCACTTGTAAAGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243042
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243042.1, NP_001229971.1
• RefSeq Size: 1586 bp
• RefSeq ORF: 1101 bp
• Locus ID: 3107
• Cytogenetics: 6p21.33
• Protein Families: Secreted Protein, Transmembrane
• Protein Pathways: Allograft rejection, Antigen processing and presentation, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Endocytosis, Graft-versus-host disease, Natural killer cell mediated cytotoxicity, Type I diabetes mellitus, Viral myocarditis
• Gene Summary: 'HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. About 6000 HLA-C alleles have been described. The HLA system plays an important role in the occurrence and outcome of infectious diseases, including those caused by the malaria parasite, the human immunodeficiency virus (HIV), and the severe acute respiratory syndrome coronavirus (SARS-CoV). The structural spike and the nucleocapsid proteins of the novel coronavirus SARS-CoV-2, which causes coronavirus disease 2019 (COVID-19), are reported to contain multiple Class I epitopes with predicted HLA restrictions. Individual HLA genetic variation may help explain different immune responses to a virus across a population.[provided by RefSeq, Aug 2020]'
  Transcript Variant: This variant (2) represents the C*07:01:01:01 allele of the HLA-C gene, as represented in the alternate locus group ALT_REF_LOCI_2 of the reference genome. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.