E2F3 (NM_001243076) Human Untagged Clone
CAT#: SC331943
E2F3 (untagged) - Homo sapiens E2F transcription factor 3 (E2F3), transcript variant 2
"NM_001243076" in other vectors (2)
Product Images
Other products for "E2F3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | E2F3 |
Synonyms | E2F-3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243076, the custom clone sequence may differ by one or more nucleotides
ATGCCCTTACAGCAGCAGGCAAAGCGAAGGCTGGAGCTAGGAGAAAGCGGTCATCAGTACCTCTCAGATG GTTTAAAAACCCCCAAGGGCAAAGGAAGAGCTGCACTACGAAGTCCAGATAGTCCAAAAAAAAAAACGCG GTATGATACGTCTCTTGGTCTGCTCACCAAGAAGTTCATTCAGCTCCTGAGCCAGTCACCCGATGGGGTA TTGGATTTGAACAAGGCAGCAGAAGTGCTAAAAGTGCAAAAGAGAAGGATTTATGATATCACCAACGTTC TGGAAGGCATCCACCTCATTAAGAAGAAGTCTAAAAACAACGTCCAATGGATGGGCTGCAGTCTGTCTGA GGATGGGGGCATGCTGGCCCAGTGTCAAGGCCTGTCAAAAGAAGTGACCGAGCTCAGTCAGGAAGAGAAG AAATTAGATGAACTGATCCAAAGCTGCACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAA GGTTAGCTTATGTTACATATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTTATAGTTGT GAAAGCCCCTCCAGAAACAAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATACATTTGGCAAGT ACCCAAGGGCCCATTGAGGTTTACTTATGTCCAGAAGAGACTGAAACACACAGTCCAATGAAAACAAACA ACCAAGACCACAATGGGAATATCCCTAAACCCGCTTCCAAAGACTTGGCTTCAACCAACTCAGGACATAG CGATTGCTCAGTTTCTATGGGAAACCTTTCTCCTCTGGCCTCCCCAGCCAACCTCTTACAGCAGACTGAG GACCAAATTCCTTCCAACCTAGAAGGACCGTTTGTGAACTTACTGCCTCCCCTGCTGCAAGAGGACTATC TCCTGAGCCTCGGGGAGGAGGAAGGCATCAGCGATCTCTTCGATGCTTACGATTTGGAAAAGCTCCCACT GGTGGAAGACTTCATGTGTAGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243076 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243076.2, NP_001230005.1 |
RefSeq Size | 4443 bp |
RefSeq ORF | 1005 bp |
Locus ID | 1871 |
Cytogenetics | 6p22.3 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Bladder cancer, Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Prostate cancer, Small cell lung cancer |
Gene Summary | 'This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]' Transcript Variant: This variant (2, also known as b) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The resulting isoform is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.