RPL13 (NM_001243130) Human Untagged Clone

CAT#: SC331951

RPL13 (untagged) - Homo sapiens ribosomal protein L13 (RPL13), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPL13
• Synonyms: BBC1; D16S44E; D16S444E; L13
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243130, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCCCAGCCGGAATGGCATGGTCTTGAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCCA
  CGTGGTTCAACCAGCCGGCCCGTAAGATCCGCAGACGTAAGGCCCGGCAAGCCAAGGCGCGCCGCATCGC
  CCCGCGCCCCGCGTCGGGTCCCATCCGGCCCATCGTGCGCTGCCCCACGGTTCGGTACCACACGAAGAAG
  GTGGCCCGGACCATCGGCATTTCTGTGGATCCGAGGAGGCGGAACAAGTCCACGGAGTCCCTGCAGGCCA
  ACGTGCAGCGGCTGAAGGAGTACCGCTCCAAACTCATCCTCTTCCCCAGGAAGCCCTCGGCCCCCAAGAA
  GGGAGACAGTTCTGCTGAAGAACTGAAACTGGCCACCCAGCTGACCGGACCGGTCATGCCCGTCCGGAAC
  GTCTATAAGAAGGAGAAAGCTCGAGTCATCACTGAGGAAGAGAAGAATTTCAAAGCCTTCGCTAGTCTCC
  GTATGGCCCGTGCCAACGCCCGGCTCTTCGGCATACGGGCAAAAAGAGCCAAGGAAGCCGCAGAACAGGA
  TGTTGAAAAGAAAAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243130
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243130.1, NP_001230059.1
• RefSeq Size: 4442 bp
• RefSeq ORF: 579 bp
• Locus ID: 6137
• Cytogenetics: 17p11.2
• Protein Families: Druggable Genome
• Protein Pathways: Ribosome
• Gene Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L13E family of ribosomal proteins. It is located in the cytoplasm. This gene is expressed at significantly higher levels in benign breast lesions than in breast carcinomas. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2011]'
  Transcript Variant: This variant (3) has an alternate splice junction in the CDS, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.