PTCRA (NM_001243170) Human Untagged Clone
CAT#: SC331964
PTCRA (untagged) - Homo sapiens pre T-cell antigen receptor alpha (PTCRA), transcript variant 4
"NM_001243170" in other vectors (2)
Product Images
Other products for "PTCRA"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTCRA |
Synonyms | PT-ALPHA; PTA |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243170, the custom clone sequence may differ by one or more nucleotides
ATGGCCGGTACATGGCTGCTACTTCTCCTGGCCCTTGGGTGTCCAGCCCTACCCACAGGAGAGGCTTCTA CAGCCAGGACCTGCCCCCAGGAGCCTCTCAGGGGGACACCGGGTGGGGCGCTGTGGCTGGGGGTCCTGCG GCTGCTGCTCTTCAAGCTGCTGCTGTTTGACCTGCTCCTGACCTGCAGCTGCCTGTGCGACCCCGCGGGC CCGCTGCCTTCCCCCGCAACCACCACCCGCCTGCGAGCCCTCGGCTCCCATCGACTGCACCCGGCCACGG AGACTGGGGGACGAGAGGCCACCAGCTCACCCAGACCCCAGCCTCGGGACCGCCGCTGGGGTGACACCCC TCCGGGTCGGAAGCCCGGGAGCCCAGTATGGGGGGAAGGGTCTTACCTCAGCAGTTACCCCACTTGCCCA GCACAGGCCTGGTGCTCAAGATCTGCCCTCAGGGCTCCTTCCTCCAGTCTTGGAGCATTTTTTGCAGGTG ACCTGCCTCCTCCTCTGCAGGCTGGAGCTGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243170 |
ORF Size | 525 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243170.1, NP_001230099.1 |
RefSeq Size | 776 |
RefSeq ORF | 525 |
Locus ID | 171558 |
Protein Families | Transmembrane |
Protein Pathways | Notch signaling pathway |
Gene Summary | The protein encoded by this gene is a single-pass type I membrane protein that is found in immmature but not mature T-cells. Along with TCRB and CD3 complex, the encoded protein forms the pre-T-cell receptor complex, which regulates early T-cell development. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011] Transcript Variant: This variant (4) lacks an alternate in-frame exon and uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (4) lacks two internal segments compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.