Aldolase (ALDOA) (NM_001243177) Human Untagged Clone
CAT#: SC331965
ALDOA (untagged) - Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 6
"NM_001243177" in other vectors (2)
Product Images
Other products for "ALDOA"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ALDOA |
Synonyms | ALDA; GSD12; HEL-S-87p |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243177, the custom clone sequence may differ by one or more nucleotides
ATGGCAAGGCGCAAGCCAGAAGGGTCCAGCTTCAACATGACCCACCTGTCCATGGCTATGGCCTTTTCCT TTCCCCCAGTTGCCAGTGGGCAACTCCACCCTCAGCTGGGCAACACCCAGCACCAGACAGAGTTAGGAAA GGAACTTGCTACTACCAGCACCATGCCCTACCAATATCCAGCACTGACCCCGGAGCAGAAGAAGGAGCTG TCTGACATCGCTCACCGCATCGTGGCACCTGGCAAGGGCATCCTGGCTGCAGATGAGTCCACTGGGAGCA TTGCCAAGCGGCTGCAGTCCATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTCTACCGCCAGCTGCT GCTGACAGCTGACGACCGCGTGAACCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACACTCTACCAG AAGGCGGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAG ACAAGGGCGTGGTCCCCCTGGCAGGGACAAATGGCGAGACTACCACCCAAGGGTTGGATGGGCTGTCTGA GCGCTGTGCCCAGTACAAGAAGGACGGAGCTGACTTCGCCAAGTGGCGTTGTGTGCTGAAGATTGGGGAA CACACCCCCTCAGCCCTCGCCATCATGGAAAATGCCAATGTTCTGGCCCGTTATGCCAGTATCTGCCAGC AGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCATGACTTGAAGCGCTGCCA GTATGTGACCGAGAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCACCACATCTACCTGGAAGGC ACCTTGCTGAAGCCCAACATGGTCACCCCAGGCCATGCTTGCACTCAGAAGTTTTCTCATGAGGAGATTG CCATGGCGACCGTCACAGCGCTGCGCCGCACAGTGCCCCCCGCTGTCACTGGGATCACCTTCCTGTCTGG AGGCCAGAGTGAGGAGGAGGCGTCCATCAACCTCAATGCCATTAACAAGTGCCCCCTGCTGAAGCCCTGG GCCCTGACCTTCTCCTACGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGCGGGAAGAAGGAGA ACCTGAAGGCTGCGCAGGAGGAGTATGTCAAGCGAGCCCTGGCCAACAGCCTTGCCTGTCAAGGAAAGTA CACTCCGAGCGGTCAGGCTGGGGCTGCTGCCAGCGAGTCCCTCTTCGTCTCTAACCACGCCTATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243177 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243177.1, NP_001230106.1 |
RefSeq Size | 1751 bp |
RefSeq ORF | 1257 bp |
Locus ID | 226 |
Cytogenetics | 16p11.2 |
Protein Families | Druggable Genome |
Protein Pathways | Fructose and mannose metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Pentose phosphate pathway |
Gene Summary | 'This gene encodes a member of the class I fructose-bisphosphate aldolase protein family. The encoded protein is a glycolytic enzyme that catalyzes the reversible conversion of fructose-1,6-bisphosphate to glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. Three aldolase isozymes (A, B, and C), encoded by three different genes, are differentially expressed during development. Mutations in this gene have been associated with Glycogen Storage Disease XII, an autosomal recessive disorder associated with hemolytic anemia. Disruption of this gene also plays a role in the progression of multiple types of cancers. Related pseudogenes have been identified on chromosomes 3 and 10. [provided by RefSeq, Sep 2017]' Transcript Variant: This variant (6) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The resulting isoform (2) is longer at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.