PIM1 (NM_001243186) Human Untagged Clone

CAT#: SC331967

PIM1 (untagged) - Homo sapiens pim-1 oncogene (PIM1), transcript variant 1


  "NM_001243186" in other vectors (2)

Reconstitution Protocol

USD 400.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "PIM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PIM1
Synonyms PIM
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243186, the custom clone sequence may differ by one or more nucleotides


CTGCCGCACGAGCCCCACGAGCCGCTCACCCCGCCGTTCTCAGCGCTGCCCGACCCCGCTGGCGCGCCCT
CCCGCCGCCAGTCCCGGCAGCGCCCTCAGTTGTCCTCCGACTCGCCCTCGGCCTTCCGCGCCAGCCGCAG
CCACAGCCGCAACGCCACCCGCAGCCACAGCCACAGCCACAGCCCCAGGCATAGCCTTCGGCACAGCCCC
GGCTCCGGCTCCTGCGGCAGCTCCTCTGGGCACCGTCCCTGCGCCGACATCCTGGAGGTTGGGATGCTCT
TGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCCACCAAGCTGGC
GCCCGGCAAGGAGAAGGAGCCCCTGGAGTCGCAGTACCAGGTGGGCCCGCTACTGGGCAGCGGCGGCTTC
GGCTCGGTCTACTCAGGCATCCGCGTCTCCGACAACTTGCCGGTGGCCATCAAACACGTGGAGAAGGACC
GGATTTCCGACTGGGGAGAGCTGCCTAATGGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGT
GAGCTCGGGTTTCTCCGGCGTCATTAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGTTTCGTCCTGATC
CTGGAGAGGCCCGAGCCGGTGCAAGATCTCTTCGACTTCATCACGGAAAGGGGAGCCCTGCAAGAGGAGC
TGGCCCGCAGCTTCTTCTGGCAGGTGCTGGAGGCCGTGCGGCACTGCCACAACTGCGGGGTGCTCCACCG
CGACATCAAGGACGAAAACATCCTTATCGACCTCAATCGCGGCGAGCTCAAGCTCATCGACTTCGGGTCG
GGGGCGCTGCTCAAGGACACCGTCTACACGGACTTCGATGGGACCCGAGTGTATAGCCCTCCAGAGTGGA
TCCGCTACCATCGCTACCATGGCAGGTCGGCGGCAGTCTGGTCCCTGGGGATCCTGCTGTATGATATGGT
GTGTGGAGATATTCCTTTCGAGCATGACGAAGAGATCATCAGGGGCCAGGTTTTCTTCAGGCAGAGGGTC
TCTTCAGAATGTCAGCATCTCATTAGATGGTGCTTGGCCCTGAGACCATCAGATAGGCCAACCTTCGAAG
AAATCCAGAACCATCCATGGATGCAAGATGTTCTCCTGCCCCAGGAAACTGCTGAGATCCACCTCCACAG
CCTGTCGCCGGGGCCCAGCAAATAG


Restriction Sites SgfI-MluI     
ACCN NM_001243186
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243186.1, NP_001230115.1
RefSeq Size 2751 bp
RefSeq ORF 1215 bp
Locus ID 5292
Cytogenetics 6p21.2
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
Protein Pathways Acute myeloid leukemia, Jak-STAT signaling pathway
Gene Summary 'The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and PIM subfamily. This gene is expressed primarily in B-lymphoid and myeloid cell lines, and is overexpressed in hematopoietic malignancies and in prostate cancer. It plays a role in signal transduction in blood cells, contributing to both cell proliferation and survival, and thus provides a selective advantage in tumorigenesis. Both the human and orthologous mouse genes have been reported to encode two isoforms (with preferential cellular localization) resulting from the use of alternative in-frame translation initiation codons, the upstream non-AUG (CUG) and downstream AUG codons (PMIDs:16186805, 1825810).[provided by RefSeq, Aug 2011]'
Transcript Variant: This variant (1) encodes two isoforms resulting from the use of alternate in-frame, translation initiation codons. This RefSeq represents the longer isoform (1, also known as Pim-1L) derived from the use of an upstream non-AUG (CUG) start codon (at nt 158-160). Pim-1L has been shown to localize primarily on the plasma membrane, and to confer resistance to chemotherapeutic drugs in prostate cancer cells (PMID:16186805).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.