Nectin 3 (NECTIN3) (NM_001243286) Human Untagged Clone

CAT#: SC331988

PVRL3 (untagged) - Homo sapiens poliovirus receptor-related 3 (PVRL3), transcript variant 2


  "NM_001243286" in other vectors (2)

Reconstitution Protocol

USD 370.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "NECTIN3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NECTIN3
Synonyms CD113; CDW113; NECTIN-3; PPR3; PRR3; PVRL3; PVRR3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243286, the custom clone sequence may differ by one or more nucleotides


ATGGCGCGGACCCTGCGGCCGTCCCCGCTGTGTCCTGGAGGCGGCAAAGCACAACTTTCCTCCGCTTCTC
TCCTCGGAGCCGGGCTCCTGCTGCAGCCCCCGACGCCACCTCCGCTGCTGCTGCTGCTCTTCCCGCTGCT
GCTCTTCTCCAGGCTCTGTGGTGCCTTAGCTGGACCAATTATTGTGGAGCCACATGTCACAGCAGTATGG
GGAAAGAATGTTTCATTAAAGTGTTTAATTGAAGTAAATGAAACCATAACACAGATTTCATGGGAGAAGA
TACATGGCAAAAGTTCACAGACTGTTGCAGTTCACCATCCCCAATATGGATTCTCTGTTCAAGGAGAATA
TCAGGGAAGAGTCTTGTTTAAAAATTACTCACTTAATGATGCAACAATTACTCTGCATAACATAGGATTC
TCTGATTCTGGAAAATACATCTGCAAAGCTGTTACATTCCCGCTTGGAAATGCCCAGTCCTCTACAACTG
TAACTGTGTTAGTTGAACCCACTGTGAGCCTGATAAAAGGGCCAGATTCTTTAATTGATGGAGGAAATGA
AACAGTAGCAGCCATTTGCATCGCAGCCACTGGAAAACCCGTTGCACATATTGACTGGGAAGGTGATCTT
GGTGAAATGGAATCCACTACAACTTCTTTTCCAAATGAAACGGCAACGATTATCAGCCAGTACAAGCTAT
TTCCAACCAGATTTGCTAGAGGAAGGCGAATTACTTGTGTTGTAAAACATCCAGCCTTGGAAAAGGACAT
CCGATACTCTTTCATATTAGACATACAGTATGCTCCTGAAGTTTCGGTAACAGGATATGATGGAAATTGG
TTTGTAGGAAGAAAAGGTGTTAATCTCAAATGTAATGCTGATGCAAATCCACCACCCTTCAAATCTGTGT
GGAGCAGGTTGGATGGACAATGGCCTGATGGTTTATTGGCTTCAGACAATACTCTTCATTTTGTCCATCC
ATTGACTTTCAATTATTCTGGTGTTTATATCTGTAAAGTGACCAATTCCCTTGGTCAAAGAAGTGACCAA
AAAGTCATCTACATTTCAGCCTACAATTCAGTGGCATCCCTCAACTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001243286
ORF Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243286.1, NP_001230215.1
RefSeq Size 5239
RefSeq ORF 1101
Locus ID 25945
Protein Families Druggable Genome, Transmembrane
Protein Pathways Adherens junction, Cell adhesion molecules (CAMs)
Gene Summary This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.