KIF13A (NM_001243423) Human Untagged Clone

CAT#: SC332000

KIF13A (untagged) - Homo sapiens kinesin family member 13A (KIF13A), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KIF13A
• Synonyms: bA500C11.2; RBKIN
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243423, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGATACCAAGGTAAAAGTTGCCGTCCGGGTCCGGCCCATGAACCGACGAGAACTGGAACTGAACA
  CCAAGTGCGTGGTGGAGATGGAAGGGAATCAAACGGTCCTGCACCCTCCTCCTTCTAACACCAAACAGGG
  AGAAAGGCTGGTCACAGTGGCTCACATCTCTAATTCCAGCACTTTGGGAGGCCAAGGCAAGAGGATCACT
  TGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243423
• ORF Size: 213 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243423.1, NP_001230352.1
• RefSeq Size: 1340
• RefSeq ORF: 213
• Locus ID: 63971
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (5) lacks several 3' exons but includes an alternate 3' exon, and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (e) shares the same N-terminus but has a distinct C-terminus and is significantly shorter than isoform a.