Ankyrin repeat domain containing protein 65 (ANKRD65) (NM_001243536) Human Untagged Clone

CAT#: SC332009

ANKRD65 (untagged) - Homo sapiens ankyrin repeat domain 65 (ANKRD65), transcript variant 3


  "NM_001243536" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ANKRD65"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ANKRD65
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243536, the custom clone sequence may differ by one or more nucleotides


ATGGACTCCCAGAGGCCTGAGCCCAGAGAGGAGGAGGAGGAGGAACAGGAACTGCGGTGGATGGAGCTGG
ACTCCGAAGAGGCCCTGGGAACCAGGACAGAGGGGCCTAGTGTTGTCCAGGGCTGGGGGCACCTGCTCCA
GGCCGTGTGGAGGGGCCCTGCAGGCCTGGTGACGCAGCTGCTGCGGCAAGGACATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001243536
ORF Size 198 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243536.1, NP_001230465.1
RefSeq Size 1645
RefSeq ORF 198
Locus ID 441869

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.