VEGFB (NM_001243733) Human Untagged Clone

CAT#: SC332025

VEGFB (untagged) - Homo sapiens vascular endothelial growth factor B (VEGFB), transcript variant VEGFB-167


  "NM_001243733" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "VEGFB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VEGFB
Synonyms VEGFL; VRF
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243733, the custom clone sequence may differ by one or more nucleotides


ATGAGCCCTCTGCTCCGCCGCCTGCTGCTCGCCGCACTCCTGCAGCTGGCCCCCGCCCAGGCCCCTGTCT
CCCAGCCTGATGCCCCTGGCCACCAGAGGAAAGTGGTGTCATGGATAGATGTGTATACTCGCGCTACCTG
CCAGCCCCGGGAGGTGGTGGTGCCCTTGACTGTGGAGCTCATGGGCACCGTGGCCAAACAGCTGGTGCCC
AGCTGCGTGACTGTGCAGCGCTGTGGTGGCTGCTGCCCTGACGATGGCCTGGAGTGTGTGCCCACTGGGC
AGCACCAAGTCCGGATGCAGATCCTCATGATCCGGTACCCGAGCAGTCAGCTGGGGGAGATGTCCCTGGA
AGAACACAGCCAGTGTGAATGCAGACCTAAAAAAAAGGACAGTGCTGTGAAGCCAGACAGCCCCAGGCCC
CTCTGCCCACGCTGCACCCAGCACCACCAGCGCCCTGACCCCCGGACCTGCCGCTGCCGCTGCCGACGCC
GCAGCTTCCTCCGTTGCCAAGGGCGGGGCTTAGAGCTCAACCCAGACACCTGCAGGTGCCGGAAGCTGCG
AAGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001243733
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243733.1, NP_001230662.1
RefSeq Size 1721 bp
RefSeq ORF 567 bp
Locus ID 7423
Cytogenetics 11q13.1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Bladder cancer, Cytokine-cytokine receptor interaction, Focal adhesion, mTOR signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma
Gene Summary 'This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]'
Transcript Variant: This variant (VEGFB-167) lacks a segment in the 3' coding region, resulting in a downstream stop codon, compared to variant VEGFB-186. The resulting isoform (VEGFB-167, also known as VRF167) has a shorter and distinct C-terminus, compared to isoform VEGFB-186. This isoform contains the heparin binding domain and is mostly sequestered in the extracellular matrix. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.