TRA2B (NM_001243879) Human Untagged Clone

CAT#: SC332051

TRA2B (untagged) - Homo sapiens transformer 2 beta homolog (Drosophila) (TRA2B), transcript variant 2


  "NM_001243879" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TRA2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRA2B
Synonyms Htra2-beta; PPP1R156; SFRS10; SRFS10; TRA2-BETA; TRAN2B
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243879, the custom clone sequence may differ by one or more nucleotides


ATGTCTACTCGCAGGCGTCATGTTGGGAATCGGGCAAATCCTGATCCTAACTGTTGTCTTGGAGTATTTG
GGCTGAGCTTGTACACCACAGAAAGAGATCTAAGAGAAGTGTTCTCTAAATATGGTCCCATTGCCGATGT
GTCTATTGTATATGACCAGCAGTCTAGGCGTTCAAGAGGATTTGCCTTTGTATATTTTGAAAATGTAGAT
GATGCCAAGGAAGCTAAAGAACGTGCCAATGGAATGGAGCTTGATGGGCGTAGGATCAGAGTTGATTTCT
CTATAACAAAAAGACCACATACGCCAACACCAGGAATTTACATGGGGAGACCTACCTATGGCAGCTCTCG
CCGTCGGGATTACTATGACAGAGGATATGATCGGGGCTATGATGATCGGGACTACTATAGCAGATCATAC
AGAGGAGGAGGTGGAGGAGGAGGAGGATGGAGAGCTGCCCAAGACAGGGATCAGATTTATAGAAGGCGGT
CACCTTCTCCTTACTATAGTCGTGGAGGATACAGATCACGTTCCAGATCTCGATCATACTCACCTCGTCG
CTATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001243879
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243879.1, NP_001230808.1
RefSeq Size 4156 bp
RefSeq ORF 567 bp
Locus ID 6434
Cytogenetics 3q27.2
Protein Families Druggable Genome
Protein Pathways Spliceosome
Gene Summary 'This gene encodes a nuclear protein which functions as sequence-specific serine/arginine splicing factor which plays a role in mRNA processing, splicing patterns, and gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]'
Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region and uses a downstream start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.