TOB (TOB1) (NM_001243885) Human Untagged Clone

CAT#: SC332052

TOB1 (untagged) - Homo sapiens transducer of ERBB2, 1 (TOB1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TOB1
• Synonyms: APRO5; APRO6; PIG49; TOB; TROB; TROB1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243885, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCATAAGTGACCCAGCCTCATCAGTGTCCAGCTCTCCATCGCCTCCTTTTGGTCACTCTGCTGCTG
  TAAGCCCTACCTTCATGCCCCGGTCCACTCAGCCTTTAACCTTTACCACTGCCACTTTTGCTGCCACCAA
  GTTCGGCTCTACCAAAATGAAGAATAGTGGCCGTAGCAACAAGGTTGCACGTACTTCTCCCATCAACCTC
  GGCTTGAATGTGAATGACCTCTTGAAGCAGAAAGCCATCTCTTCCTCAATGCACTCTCTGTATGGGCTTG
  GCTTGGGTAGCCAGCAGCAGCCACAGCAACAGCAGCAGCCAGCCCAGCCGCCACCGCCACCACCACCACC
  ACAGCAGCAACAACAGCAGAAAACCTCTGCTCTTTCTCCTAATGCCAAGGAATTTATTTTTCCTAATATG
  CAGGGTCAAGGTAGTAGTACCAATGGAATGTTCCCAGGTGACAGCCCCCTTAACCTCAGTCCTCTCCAGT
  ACAGTAATGCCTTTGATGTGTTTGCAGCCTATGGAGGCCTCAATGAGAAATCTTTTGTAGATGGCTTGAA
  TTTTAGCTTAAATAACATGCAGTATTCTAACCAGCAATTCCAGCCTGTTATGGCTAACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243885
• ORF Size: 621 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243885.1, NP_001230814.1
• RefSeq Size: 2056
• RefSeq ORF: 621
• Locus ID: 10140
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1.