Keratinocyte differentiation associated protein (KRTDAP) (NM_001244847) Human Untagged Clone

CAT#: SC332098

KRTDAP (untagged) - Homo sapiens keratinocyte differentiation-associated protein (KRTDAP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KRTDAP
• Synonyms: KDAP; UNQ467
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244847, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGATCCCGGTCCTTCCTGCCGTGGTGCTCCTCTCCCTCCTGGTGCTCCACTCTGCCCAGGGAGCCA
  CCCTGGGTGGTCCTGAGGAAGAAAGCACCATTGAGAATTATGCGTCACGACCCGAGGCGTTTAAGGCTGA
  TGAGTTCCTGAACTGGCACGCCCTCTTTGAGTCTATCAAAAGGAAACTTCCTTTCCTCAACTGGGATGCC
  TTTCCTAAGCTGAAAGGACTGAGGAGCGCAACTCCTGATGCCCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244847
• ORF Size: 258 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001244847.1, NP_001231776.1
• RefSeq Size: 458
• RefSeq ORF: 258
• Locus ID: 388533
• Gene Summary: This gene encodes a protein which may function in the regulation of keratinocyte differentiation and maintenance of stratified epithelia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.