SEL1L (NM_001244984) Human Untagged Clone

CAT#: SC332110

SEL1L (untagged) - Homo sapiens sel-1 suppressor of lin-12-like (C. elegans) (SEL1L), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SEL1L
• Synonyms: Hrd3; PRO1063; SEL1-LIKE; SEL1L1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244984, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGGTCCGGATAGGGCTGACGCTGCTGCTGTGTGCGGTGCTGCTGAGCTTGGCCTCGGCGTCCTCGG
  ATGAAGAAGGCAGCCAGGATGAATCCTTAGATTCCAAGACTACTTTGACATCAGATGAGTCAGTAAAGGA
  CCATACTACTGCAGGCAGAGTAGTTGCTGGTCAAATATTTCTTGATTCAGAAGAATCTGAATTAGAATCC
  TCTATTCAAGAAGAGGAAGACAGCCTCAAGAGCCAAGAGGGGGAAAGTGTCACAGAAGATATCAGCTTTC
  TAGAGTCTCCAAATCCAGAAAACAAGGACTATGAAGAGCCAAAGAAAGTACGGAAACCAGCTTTGACCGC
  CATTGAAGGCACAGCACATGGGGAGCCCTGCCACTTCCCTTTTCTTTTCCTAGATAAGGAGTATGATGAA
  TGTACATCAGATGGGAGGGAAGATGGCAGACTGTGGTGTGCTACAACCTATGACTACAAAGCAGATGAAA
  AGTGGGGCTTTTGTGAAACTGAAGAAGAGGCTGCTAAGAGACGGCAGATGCAGGAAGCAGAAATGATGTA
  TCAAACTGGAATGAAAATCCTTAATGGAAGCAATAAGAAAAGCCAAAAAAGAGAAGCATATCGGTATCTC
  CAAAAGGCAGCAAGCATGAACCATACCAAAGCCCTGGAGAGAGTGTCATATGCTCTTTTATTTGGTGATT
  ACTTGCCACAGAATATCCAGGCAGCGAGAGAGATGTTTGAGAAGCTGACTGAGGAAGGCTCTCCCAAGGG
  ACAGACTGCTCTTGGCTTTCTGTATGCCTCTGGACTTGGTGTTAATTCAAGTCAGGCAAAGGCTCTTGTA
  TATTATACATTTGGAGCTCTTGGGGGCAATCTAATAGCCCACATGGTTTTGGTAAGTAGACTTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244984
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001244984.1, NP_001231913.1
• RefSeq Size: 1675 bp
• RefSeq ORF: 906 bp
• Locus ID: 6400
• Cytogenetics: 14q31.1
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: 'The protein encoded by this gene is part of a protein complex required for the retrotranslocation or dislocation of misfolded proteins from the endoplasmic reticulum lumen to the cytosol, where they are degraded by the proteasome in a ubiquitin-dependent manner. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus compared to isoform 1.