PAPOLA (NM_001252007) Human Untagged Clone

CAT#: SC332163

PAPOLA (untagged) - Homo sapiens poly(A) polymerase alpha (PAPOLA), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PAPOLA
• Synonyms: PAP; PAP-alpha
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252007, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGTTTCCAGTTACAACACAGGGATCACAACAAACACAACCGCCACAGAAGCACTATGGCATTACTT
  CTCCTATCAGCTTAGCAGCCCCCAAGGAGACTGACTGCGTACTTACACAGAAACTAATTGAGACATTGAA
  ACCCTTTGGGGTTTTTGAAGAGGAAGAGGAACTGCAGCGCAGGATTTTAATTTTGGGAAAACTAAATAAC
  CTGGTAAAAGAGTGGATACGAGAAATCAGTGAAAGCAAGAATCTTCCACAATCTGTAATTGAAAATGTTG
  GAGGAAAAATTTTTACATTTGGATCTTACAGATTAGGAGTGCATACAAAAGGTGCTGATATTGATGCGTT
  GTGTGTTGCACCAAGACATGTTGATCGAAGTGACTTTTTCACCTCATTCTATGATAAGTTGAAATTACAG
  GAAGAAGTAAAAGATTTAAGAGCTGTTGAAGAGGCATTCGTACCAGTTATTAAACTCTGTTTTGATGGGA
  TAGAGATTGATATTTTGTTTGCAAGATTAGCACTGCAGACAATTCCTGAAGATTTGGATCTACGAGATGA
  CAGTCTGCTAAAAAATTTAGATATAAGATGTATAAGAAGTCTTAACGGTATGAGAAAGCCTACTTCCTTT
  TGTGTACTTCAGTTTTTGTCAGATATTAGTTGTTTTTACACAAGTTTTGTATTGAAGCTTTTTATAGCTA
  TATTGTTAACACAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252007
• ORF Size: 717 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001252007.1, NP_001238936.1
• RefSeq Size: 4847
• RefSeq ORF: 717
• Locus ID: 10914
• Protein Families: Transcription Factors
• Protein Pathways: RNA degradation
• Gene Summary: The protein encoded by this gene belongs to the poly(A) polymerase family. It is required for the addition of adenosine residues for the creation of the 3'-poly(A) tail of mRNAs. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (3) lacks multiple exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.