CEBP gamma (CEBPG) (NM_001252296) Human Untagged Clone

CAT#: SC332185

CEBPG (untagged) - Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma (CEBPG), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CEBPG
• Synonyms: GPE1BP; IG/EBP-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252296, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCAAGATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATCCATACCCAGGCAC
  ATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCTGGGGGAGGAGGCAAAGCTGTGGC
  TCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGATCGAAACAGTGACGAGTATCGGCAACGCCGAGAG
  AGGAACAACATGGCTGTGAAAAAGAGCCGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAGAGAG
  TCAATCAGCTCAAAGAAGAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGT
  ACTCAAAGATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAAAAT
  ACGACAGCAGATGGCGACAATGCAGGACAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252296
• ORF Size: 453 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001252296.1, NP_001239225.1
• RefSeq Size: 3647
• RefSeq ORF: 453
• Locus ID: 1054
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: The C/EBP family of transcription factors regulates viral and cellular CCAAT/enhancer element-mediated transcription. C/EBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. The C/EBP family consist of several related proteins, C/EBP alpha, C/EBP beta, C/EBP gamma, and C/EBP delta, that form homodimers and that form heterodimers with each other. CCAAT/enhancer binding protein gamma may cooperate with Fos to bind PRE-I enhancer elements. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.