TBPL1 (NM_001253676) Human Untagged Clone

CAT#: SC332215

TBPL1 (untagged) - Homo sapiens TBP-like 1 (TBPL1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TBPL1
• Synonyms: MGC:8389; MGC:9620; STUD; TLF; TLP; TRF2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001253676, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATGCAGACAGTGATGTTGCATTGGACATTCTAATTACAAATGTAGTCTGTGTTTTTAGAACAAGAT
  GTCATTTAAACTTAAGGAAGATTGCTTTGGAAGGAGCAAATGTAATTTATAAACGTGATGTTGGAAAAGT
  ATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGA
  GCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGCTTAGCCCGTAGTCTGCAGAAACTAGGTTTTC
  AGGTAATATTTACAGATTTTAAGGTTGTTAACGTTCTGGCAGTGTGTAACATGCCATTTGAAATCCGTTT
  GCCAGAATTCACAAAGAACAATAGACCTCATGCCAGTTACGAACCTGAACTTCATCCTGCTGTGTGCTAT
  CGGATAAAATCTCTAAGAGCTACATTACAGATTTTTTCAACAGGAAGTATCACAGTAACAGGGCCCAATG
  TAAAGGCTGTTGCTACTGCTGTGGAACAGATTTACCCATTTGTGTTTGAAAGCAGGAAAGAAATTTTATA
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253676
• ORF Size: 561 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001253676.1, NP_001240605.1
• RefSeq Size: 1635
• RefSeq ORF: 561
• Locus ID: 9519
• Protein Families: Transcription Factors
• Protein Pathways: Basal transcription factors, Huntington's disease
• Gene Summary: This gene encodes a member of the TATA box-binding protein family. TATA box-binding proteins play a critical role in transcription by RNA polymerase II as components of the transcription factor IID (TFIID) complex. The encoded protein does not bind to the TATA box and initiates transcription from TATA-less promoters. This gene plays a critical role in spermatogenesis, and single nucleotide polymorphisms in this gene may be associated with male infertility. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.