CREB3L2 (NM_001253775) Human Untagged Clone

CAT#: SC332224

CREB3L2 (untagged) - Homo sapiens cAMP responsive element binding protein 3-like 2 (CREB3L2), transcript variant 2


  "NM_001253775" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CREB3L2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CREB3L2
Synonyms BBF2H7
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001253775, the custom clone sequence may differ by one or more nucleotides


ATGGAGGTGCTGGAGAGCGGGGAGCAGGGCGTGCTGCAGTGGGACCGCAAGCTGAGCGAGCTGTCAGAGC
CCGGGGACGGCGAGGCCCTCATGTACCACACGCACTTCTCAGAACTTCTGGATGAGTTTTCCCAGAACGT
CTTGGGTCAGCTCCTGAATGATCCTTTCCTCTCAGAGAAGAGTGTGTCAATGGAGGTGGAACCTTCCCCG
ACGTCCCCGGCGCCTCTCATCCAGGCTGAGCACAGCTACTCCCTGTGCGAGGAGCCTCGGGCCCAGTCGC
CCTTCACCCACATTACCACCAGTGACAGCTTCAATGACGATGAGGTGGAAAGTGAGAAATGGTACCTGTC
TACAGACTTCCCTTCAACATCCATCAAGACAGAGCCAGTTACAGACGAACCACCCCCAGGACTCGTTCCG
TCTGTCACTCTGACCATCACAGCCATCTCCACCCCGTTGGAAAAGGAGGAACCTCCTCTGGAAATGAACA
CTGGGGTTGATTCCTCGTGCCAGACCATTATTCCTAAAATTAAGCTGGAGCCTCATGAAGTGGATCAGTT
TCTAAACTTCTCTCCTAAAGAAGGTCTGTCTGCCCTCCCTGTGTCCCTTTGGGTTATGGATATGGTCTCT
GGGTCTACAGAGAGGGAATATGGCGAGAGAGCTGGGATGAGTTTGTACCACAGATGTTGTAGCTGGCTTT
ATGAAATAGCTCTGTTCTTAAAAAATAAAAATTTTGCTTCCAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001253775
ORF Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001253775.1, NP_001240704.1
RefSeq Size 1175
RefSeq ORF 747
Locus ID 64764
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Melanogenesis, Prostate cancer
Gene Summary This gene encodes a member of the oasis bZIP transcription factor family. Members of this family can dimerize but form homodimers only. The encoded protein is a transcriptional activator. Translocations between this gene on chromosome 7 and the gene fused in sarcoma on chromosome 16 can be found in some tumors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.