UXS 1 (UXS1) (NM_001253876) Human Untagged Clone
CAT#: SC332248
UXS1 (untagged) - Homo sapiens UDP-glucuronate decarboxylase 1 (UXS1), transcript variant 3
"NM_001253876" in other vectors (2)
Product Images
Other products for "UXS1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UXS1 |
Synonyms | SDR6E1; UGD |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001253876, the custom clone sequence may differ by one or more nucleotides
ATGTATAATCCTATCAAGACATTAAAGACCAATACGATTGGGACATTAAACATGTTGGGGCTGGCAAAAC GAGTCGGTGCCCGTCTGCTCCTGGCCTCCACATCGGAGGTGTATGGAGATCCTGAAGTCCACCCTCAAAG TGAGGATTACTGGGGCCACGTGAATCCAATAGGACCTCGGGCCTGCTACGATGAAGGCAAACGTGTTGCA GAGACCATGTGCTATGCCTACATGAAGCAGGAAGGCGTGGAAGTGCGAGTGGCCAGAATCTTCAACACCT TTGGGCCACGCATGCACATGAACGATGGGCGAGTAGTCAGCAACTTCATCCTGCAGGCGCTCCAGGGGGA GCCACTCACGGTATACGGATCCGGGTCTCAGACAAGGGCGTTCCAGTACGTCAGCGATCTAGTGAATGGC CTCGTGGCTCTCATGAACAGCAACGTCAGCAGCCCGGTCAACCTGGGGAACCCAGAAGAACACACAATCC TAGAATTTGCTCAGTTAATTAAAAACCTTGTTGGTAGCGGAAGTGAAATTCAGTTTCTCTCCGAAGCCCA GGATGACCCACAGAAAAGAAAACCAGACATCAAAAAAGCAAAGCTGATGCTGGGGTGGGAGCCCGTGGTC CCGCTGGAGGAAGGTTTAAACAAAGCAATTCACTACTTCCGTAAAGAACTCGAGTACCAGGCAAATAATC AGTACATCCCCAAACCAAAGCCTGCCAGAATAAAGAAAGGACGGACTCGCCACAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001253876 |
ORF Size | 759 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001253876.1, NP_001240805.1 |
RefSeq Size | 2254 |
RefSeq ORF | 759 |
Locus ID | 80146 |
Protein Families | Transmembrane |
Protein Pathways | Amino sugar and nucleotide sugar metabolism, Metabolic pathways, Starch and sucrose metabolism |
Gene Summary | This gene encodes an enzyme found in the perinuclear Golgi which catalyzes the synthesis of UDP-xylose used in glycosaminoglycan (GAG) synthesis on proteoglycans. The GAG chains are covalently attached to proteoglycans which participate in signaling pathways during development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (3) differs in the 5' UTR, lacks several exons in the 5' coding region, and uses a downstream AUG compared to variant 1. The resulting protein (isoform 3) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.