UXS 1 (UXS1) (NM_001253876) Human Untagged Clone

CAT#: SC332248

UXS1 (untagged) - Homo sapiens UDP-glucuronate decarboxylase 1 (UXS1), transcript variant 3


  "NM_001253876" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "UXS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UXS1
Synonyms SDR6E1; UGD
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001253876, the custom clone sequence may differ by one or more nucleotides


ATGTATAATCCTATCAAGACATTAAAGACCAATACGATTGGGACATTAAACATGTTGGGGCTGGCAAAAC
GAGTCGGTGCCCGTCTGCTCCTGGCCTCCACATCGGAGGTGTATGGAGATCCTGAAGTCCACCCTCAAAG
TGAGGATTACTGGGGCCACGTGAATCCAATAGGACCTCGGGCCTGCTACGATGAAGGCAAACGTGTTGCA
GAGACCATGTGCTATGCCTACATGAAGCAGGAAGGCGTGGAAGTGCGAGTGGCCAGAATCTTCAACACCT
TTGGGCCACGCATGCACATGAACGATGGGCGAGTAGTCAGCAACTTCATCCTGCAGGCGCTCCAGGGGGA
GCCACTCACGGTATACGGATCCGGGTCTCAGACAAGGGCGTTCCAGTACGTCAGCGATCTAGTGAATGGC
CTCGTGGCTCTCATGAACAGCAACGTCAGCAGCCCGGTCAACCTGGGGAACCCAGAAGAACACACAATCC
TAGAATTTGCTCAGTTAATTAAAAACCTTGTTGGTAGCGGAAGTGAAATTCAGTTTCTCTCCGAAGCCCA
GGATGACCCACAGAAAAGAAAACCAGACATCAAAAAAGCAAAGCTGATGCTGGGGTGGGAGCCCGTGGTC
CCGCTGGAGGAAGGTTTAAACAAAGCAATTCACTACTTCCGTAAAGAACTCGAGTACCAGGCAAATAATC
AGTACATCCCCAAACCAAAGCCTGCCAGAATAAAGAAAGGACGGACTCGCCACAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001253876
ORF Size 759 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001253876.1, NP_001240805.1
RefSeq Size 2254
RefSeq ORF 759
Locus ID 80146
Protein Families Transmembrane
Protein Pathways Amino sugar and nucleotide sugar metabolism, Metabolic pathways, Starch and sucrose metabolism
Gene Summary This gene encodes an enzyme found in the perinuclear Golgi which catalyzes the synthesis of UDP-xylose used in glycosaminoglycan (GAG) synthesis on proteoglycans. The GAG chains are covalently attached to proteoglycans which participate in signaling pathways during development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks several exons in the 5' coding region, and uses a downstream AUG compared to variant 1. The resulting protein (isoform 3) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.