RGS5 (NM_001254749) Human Untagged Clone
CAT#: SC332267
RGS5 (untagged) - Homo sapiens regulator of G-protein signaling 5 (RGS5), transcript variant 4
"NM_001254749" in other vectors (2)
Product Images
Other products for "RGS5"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RGS5 |
Synonyms | MST092; MST106; MST129; MSTP032; MSTP092; MSTP106; MSTP129 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001254749, the custom clone sequence may differ by one or more nucleotides
ATGTGCAAAGGACTTGCAGCTTTGCCCCACTCATGCCTGGAAAGGGCCAAGGAGATTAAGATCAAGTTGG GAATTCTCCTCCAGAAGCCAGACTCAGTTGGTGACCTTGTCATTCCGTACAATGAGAAGCCAGAGAAACC AGCCAAGACCCAGAAAACCTCGCTGGACGAGGCCCTGCAGTGGCGTGATTCCCTGGACAAACTCCTGCAG AACAACTATGGACTTGCCAGTTTCAAAAGTTTCCTGAAGTCTGAATTCAGTGAGGAAAACCTTGAGTTCT GGATTGCCTGTGAGGATTACAAGAAGATCAAGTCCCCTGCCAAGATGGCTGAGAAGGCAAAGCAAATTTA TGAAGAATTCATTCAAACGGAGGCTCCTAAAGAGGTTGGTCTCTGGGTGAATATTGACCACTTCACTAAG GACATCACAATGAAGAACCTGGTGGAACCTTCCCTGAGCAGCTTTGACATGGCCCAGAAAAGAATCCATG CCCTGATGGAAAAGGATTCTCTGCCTCGCTTTGTGCGCTCTGAGTTTTATCAGGAGTTAATCAAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001254749 |
ORF Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001254749.1, NP_001241678.1 |
RefSeq Size | 5949 |
RefSeq ORF | 558 |
Locus ID | 8490 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the regulators of G protein signaling (RGS) family. The RGS proteins are signal transduction molecules which are involved in the regulation of heterotrimeric G proteins by acting as GTPase activators. This gene is a hypoxia-inducible factor-1 dependent, hypoxia-induced gene which is involved in the induction of endothelial apoptosis. This gene is also one of three genes on chromosome 1q contributing to elevated blood pressure. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in an isoform (3) that is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.