PSMC3IP (NM_001256015) Human Untagged Clone

CAT#: SC332281

PSMC3IP (untagged) - Homo sapiens PSMC3 interacting protein (PSMC3IP), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSMC3IP
• Synonyms: GT198; HOP2; HUMGT198A; ODG3; TBPIP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256015, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGAGTGATGCTGACCTTCAAGTCCTAGATGGCAAAATCGTGGCCCTCACTGCTAAGGTGCAGAGCT
  TGCAGCAGAGCTGCCGCTACATGGAGGCTGAGCTCAAGGAATTATCTAGTGCCCTGACCACACCAGAGAT
  GCAGAAAGAAATCCAGGAGTTAAAGAAGGAATGCGCTGGCTACAGAGAGAGATTGAAGAACATTAAAGCA
  GCTACCAATCATGTGACTCCAGAAGAGAAAGAGCAGGTGTACAGAGAGAGGCAGAAGTACTGTAAGGAGT
  GGAGGAAGAGGAAGAGGATGGCTACAGAGCTGTCTGATGCAATACTTGAAGGATACCCCAAGAGCAAGAA
  GCAGTTCTTTGAGGAAGTTGGGATAGAGACGGATGAAGATTACAACGTCACACTCCCAGACCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256015
• ORF Size: 417 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256015.1, NP_001242944.1
• RefSeq Size: 1609
• RefSeq ORF: 417
• Locus ID: 29893
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that functions in meiotic recombination. It is a subunit of the PSMC3IP/MND1 complex, which interacts with PSMC3/TBP1 to stimulate DMC1- and RAD51-mediated strand exchange during meiosis. The protein encoded by this gene can also co-activate ligand-driven transcription mediated by estrogen, androgen, glucocorticoid, progesterone, and thyroid nuclear receptors. Mutations in this gene cause XX female gonadal dysgenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (4) uses an alternate splice site in an internal exon, and thus differs in its 5' UTR and uses a downstream in-frame start codon, compared to variant 2. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 2. Both variants 4 and 5 encode isoform 4.