TRDN (NM_001256020) Human Untagged Clone

CAT#: SC332284

TRDN (untagged) - Homo sapiens triadin (TRDN), transcript variant 3


  "NM_001256020" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TRDN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRDN
Synonyms CPVT5; TDN; TRISK
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256020, the custom clone sequence may differ by one or more nucleotides


ATGACTGAGATCACTGCTGAAGGAAATGCATCTACAACCACAACTGTGATAGACAGCAAAAATGGATCTG
TGCCCAAATCCCCCGGAAAAGTGCTGAAGAGGACAGTCACAGAAGACATAGTGACGACGTTCAGCTCCCC
TGCAGCCTGGCTTCTGGTCATTGCCCTGATAATCACGTGGTCAGCTGTTGCCATCGTTATGTTTGATTTA
GTGGATTACAAAAACTTTTCAGCAAGCTCTATTGCCAAGATTGGCTCAGATCCTTTAAAACTGGTACGTG
ATGCTATGGAGGAAACCACGGACTGGATCTATGGCTTCTTTTCTTTGTTATCTGACATCATCTCATCTGA
AGATGAAGAAGATGATGATGGTGACGAAGATACTGATAAAGGAGAAATAGATGAGCCTCCCTTGAGAAAA
AAAGAAATACACAAAGATAAGACTGAAAAACAAGAGAAACCTGAAAGGAAAATACAAACTAAAGTTACAC
ACAAAGAAAAAGAAAAAGGAAAAGAAAAAGTAAGAGAAAAAGAAAAACCTGAAAAGAAAGCAACTCACAA
GGAAAAAATTGAGAAAAAAGAAAAACCAGAAACAAAGACACTGGCGAAAGAACAGAAGAAAGCTAAGACT
GCAGAAAAGAGTGAAGAAAAGACTAAAAAGGAAGTGAAAGGTGGAAAACAGGAGAAAGTGAAGCAAACAG
CTGCAAAAGTAAAAGAAGTACAGAAAACACCATCAAAACCCAAAGAAAAGGAGGACAAAGAGAAAGCAGC
TGTGTCAAAGCATGAACAGAAAGGACAAAGCCCAGCCATTCCACCTCCCTTACCGACAGAACAAGCTTCC
AGACCCACTCCGGCATCACCTGCCCTTGAAGGCAAGTACTTTTTTTTTTCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001256020
ORF Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256020.1, NP_001242949.1
RefSeq Size 1864
RefSeq ORF 894
Locus ID 10345
Protein Families Transmembrane
Gene Summary This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) lacks several 3' exons but contains an alternate 3' end, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct and significantly shorter C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.