TRDN (NM_001256021) Human Untagged Clone

CAT#: SC332285

TRDN (untagged) - Homo sapiens triadin (TRDN), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRDN
• Synonyms: CPVT5; TDN; TRISK
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256021, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTGAGATCACTGCTGAAGGAAATGCATCTACAACCACAACTGTGATAGACAGCAAAAATGGATCTG
  TGCCCAAATCCCCCGGAAAAGTGCTGAAGAGGACAGTCACAGAAGACATAGTGACGACGTTCAGCTCCCC
  TGCAGCCTGGCTTCTGGTCATTGCCCTGATAATCACGTGGTCAGCTGTTGCCATCGTTATGTTTGATTTA
  GTGGATTACAAAAACTTTTCAGCAAGCTCTATTGCCAAGATTGGCTCAGATCCTTTAAAACTGGTACGTG
  ATGCTATGGAGGAAACCACGGACTGGATCTATGGCTTCTTTTCTTTGTTATCTGACATCATCTCATCTGA
  AGATGAAGAAGATGATGATGGTGACGAAGATACTGATAAAGGAGAAATAGATGAGCCTCCCTTGAGAAAA
  AAAGAAATACACAAAGATAAGACTGAAAAACAAGAGAAACCTGAAAGGAAAATACAAACTAAAGTTACAC
  ACAAAGAAAAAGAAAAAGGAAAAGAAAAAGTAAGAGAAAAAGAAAAACCTGAAAAGAAAGCAACTCACAA
  GGAAAAAATTGAGAAAAAAGAAAAACCAGAAACAAAGACACTGGCGAAAGAACAGAAGAAAGCTAAGACT
  GCAGAAAAGAGTGAAGAAAAGACTAAAAAGGAAGTGAAAGGTGGAAAACAGGAGAAAGTGAAGCAAACAG
  CTGCAAAAGTAAAAGAAGTACAGAAAACACCATCAAAACCCAAAGAAAAGGAGGACAAAGAGAAAGCAGC
  TGTGTCAAAGCATGAACAGAAAGGTAAACATTCAGAGCAGGAGGCTGCCGGAGGTTCTAAGAGAATATTG
  GGCAAGAAGCACATGCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256021
• ORF Size: 861 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256021.1, NP_001242950.1
• RefSeq Size: 3002
• RefSeq ORF: 861
• Locus ID: 10345
• Protein Families: Transmembrane
• Gene Summary: This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (4) lacks several 3' exons but contains an alternate 3' end, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4, also known as Trisk 32) has a distinct and significantly shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.