PGAP2 (NM_001256237) Human Untagged Clone

CAT#: SC332321

PGAP2 (untagged) - Homo sapiens post-GPI attachment to proteins 2 (PGAP2), transcript variant 9


  "NM_001256237" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PGAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PGAP2
Synonyms CWH43-N; FRAG1; HPMRS3; MRT17; MRT21
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256237, the custom clone sequence may differ by one or more nucleotides


ATGGCTAGATTGGGAAGCACCGGCGGGGTGTCGGGAAGGGTGGTGACGCAACATAGAGACTCCGCCCCCT
TCCTTGGAGCGCCGCGACTCGGGCTGAGGGAGCTCGGGCCAATCAGAGGGACGGCCCCAGAATGGCATGG
TAGATGGAACGCAGCTGAGAGGTCTGACAAGATGTACCAGGTCCCACTACCACTGGATCGGGATGGGACC
CTGGTACGGCTCCGCTTCACCATGGTGGCCCTGGTCACGGTCTGCTGTCCACTTGTCGCCTTCCTCTTCT
GCATCCTCTGGTCCCTGCTCTTCCACTTCAAGGAGACAACGGCCACACACTGTGGGGTGCCCAATTACCT
GCCCTCGGTGAGCTCAGCCATCGGCGGGGAGGTGCCCCAGCGCTACGTGTGGCGTTTCTGCATCGGCCTG
CACTCGGCGCCTCGCTTCTTGGTGGCCTTCGCCTACTGGAACCACTACCTCAGCTGCACCTCCCCGTGTT
CCTGCTATCGCCCGCTCTGCCGCCTCAACTTCGGCCTCAATGTCGTGGAGAACCTCGCGTTGCTAGTGCT
CACTTATGTCTCCTCCTCCGAGGACTTCACCATCCACGAAAATGCTTTCATTGTGTTCATTGCCTCATCC
CTCGGGCACATGCTCCTCACCTGCATTCTCTGGCGGTTGACCAAGAAGCACACAGTAAGTCAGGAGGTAC
GGTCTATCCCTAGCGGGGGCTCCAAGGCAGCCCAGAAGAAAATCAAGGACATCTGTCCTCAGGATTCGGG
TAATGGATCGCAAGTCCTACAGCTGGAAACAGCGGCTCTTCATCATCAACTTCATCTCCTTCTTCTCGGC
GCTGGCTGTCTACTTTCGGCACAACATGTATTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256237
ORF Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256237.1, NP_001243166.1
RefSeq Size 1967
RefSeq ORF 876
Locus ID 27315
Protein Families Druggable Genome, Transmembrane
Gene Summary The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (9) contains alternate 5' exon structure and thus differs in the 5' UTR and 5' coding region, lacks an alternate in-frame exon in the central coding region, and uses an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (5) has distinct N- and C-termini and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.