PGAP2 (NM_001256238) Human Untagged Clone

CAT#: SC332322

PGAP2 (untagged) - Homo sapiens post-GPI attachment to proteins 2 (PGAP2), transcript variant 10

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGAP2
• Synonyms: CWH43-N; FRAG1; HPMRS3; MRT17; MRT21
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256238, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACCAGGTCCCACTACCACTGGATCGGGATGGGACCCTGGTACGGCTCCGCTTCACCATGGTGGCCC
  TGGTCACGGTCTGCTGTCCACTTGTCGCCTTCCTCTTCTGCATCCTCTGGTCCCTGCTCTTCCACTTCAA
  GGAGACAACGGCCACACACTGTGGGGTGCCCAATTACCTGCCCTCGGTGAGCTCAGCCATCGGCGGGGAG
  GTGCCCCAGCGCTACGTGTGGCGTTTCTGCATCGGCCTGCACTCGGCGCCTCGCTTCTTGGTGGCCTTCG
  CCTACTGGAACCACTACCTCAGCTGCACCTCCCCGTGTTCCTGCTATCGCCCGCTCTGCCGCCTCAACTT
  CGGCCTCAATGTCGTGGAGAACCTCGCGTTGCTAGTGCTCACTTATGTCTCCTCCTCCGAGGACTTCACC
  ATCCACGAAAATGCTTTCATTGTGTTCATTGCCTCATCCCTCGGGCACATGCTCCTCACCTGCATTCTCT
  GGCGGTTGACCAAGAAGCACACAGTAAGTCAGGAGGTACGGTCTATCCCTAGCGGGGGCTCCAAGGCAGC
  CCAGAAGAAAATCAAGGACATCTGTCCTCAGGATTCGGGATCGCAAGTCCTACAGCTGGAAACAGCGGCT
  CTTCATCATCAACTTCATCTCCTTCTTCTCGGCGCTGGCTGTCTACTTTCGGCACAACATGTATTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256238
• ORF Size: 699 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256238.1, NP_001243167.1
• RefSeq Size: 1875
• RefSeq ORF: 699
• Locus ID: 27315
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017]
  Transcript Variant: This variant (10) differs in the 5' UTR, lacks an alternate in-frame exon in the 5' coding region, and uses an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (6) has a distinct C-terminus and is shorter than isoform 1.