Prostaglandin dehydrogenase 1 (HPGD) (NM_001256307) Human Untagged Clone
CAT#: SC332341
HPGD (untagged) - Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), transcript variant 6
"NM_001256307" in other vectors (2)
Product Images
Other products for "HPGD"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HPGD |
Synonyms | 15-PGDH; PGDH; PGDH1; PHOAR1; SDR36C1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256307, the custom clone sequence may differ by one or more nucleotides
ATGAGTAAGCAAAATGGAGGTGAAGGCGGCATCATTATCAATATGTCATCTTTAGCAGGACTCATGCCCG TTGCACAGCAGCCGGTTTATTGTGCTTCAAAGCATGGCATAGTTGGATTCACACGCTCAGCAGCGTTGGC TGCTAATCTTATGAACAGTGGTGTGAGACTGAATGCCATTTGTCCAGGCTTTGTTAACACAGCCATCCTT GAATCAATTGAAAAAGAAGAAAACATGGGACAATATATAGAATATAAGGATCATATCAAGGATATGATTA AATACTATGGAATTTTGGACCCACCATTGATTGCCAATGGATTGATAACACTCATTGAAGATGATGCTTT AAATGGTGCTATTATGAAGATCACAACTTCTAAGGGAATTCATTTTCAAGACTATGATACAACTCCATTT CAAGCAAAAACCCAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256307 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256307.1, NP_001243236.1 |
RefSeq Size | 2937 bp |
RefSeq ORF | 438 bp |
Locus ID | 3248 |
Cytogenetics | 4q34.1 |
Protein Families | Druggable Genome |
Gene Summary | 'This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]' Transcript Variant: This variant (6) lacks a 5' exon compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a weak Kozak sequence and a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG, to encode an isoform (3) with a shorter N-terminus, compared to isoform 1. Variants 3 and 6 encode the same protein (isoform 3). |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.