HVCN1 (NM_001256413) Human Untagged Clone

CAT#: SC332374

HVCN1 (untagged) - Homo sapiens hydrogen voltage-gated channel 1 (HVCN1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HVCN1
• Synonyms: HV1; VSOP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256413, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCAAGTTCTTAAGGCACTTCACGGTCGTGGGAGACGACTACCATGCCTGGAACATCAACTACAAGA
  AATGGGAGAATGAAGAGGAGGAGGAGGAGGAGGAGCAGCCACCACCCACACCAGTCTCAGGCGAGGAAGG
  CAGAGCTGCAGCCCCTGACGTTGCCCCTGCCCCTGGCCCCGCACCCAGGGCCCCCCTTGACTTCAGGGGC
  ATGTTGAGGAAACTGTTCAGCTCCCACAGGTTTCAGGTCATCATCATCTGCTTGGTGGTTCTGGATGCCC
  TCCTGGTGCTTGCTGAGCTCATCCTGGACCTGAAGATCATCCAGCCCGACAAGAATAACTATGCTGCCAT
  GGTATTCCACTACATGAGCATCACCATCTTGGTCTTTTTTATGATGGAGATCATCTTTAAATTATTTGTC
  TTCCGCCTGGAGTTCTTTCACCACAAGTTTGAGATCCTGGATGCCGTCGTGGTGGTGGTCTCATTCATCC
  TCGACATTGTCCTCCTGTTCCAGGAGCACCAGTTTGAGGCTCTGGGCCTGCTGATTCTGCTCCGGCTGTG
  GCGGGTGGCCCGGATCATCAATGGGATTATCATCTCAGTTAAGACACGTTCAGAACGGCAACTCTTAAGG
  TTAAAACAGATGAATGTACAATTGGCCGCCAAGATTCAACACCTTGAGTTCAGCTGCTCTGAGAAGGAAC
  AAGAAATTGAAAGACTTAACAAACTATTGCGACAGCATGGACTTCTTGGTGAAGTGAACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256413
• ORF Size: 762 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256413.1, NP_001243342.1
• RefSeq Size: 1696
• RefSeq ORF: 762
• Locus ID: 84329
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a voltage-gated protein channel protein expressed more highly in certain cells of the immune system. Phagocytic cells produce superoxide anions which require this channel protein, and in B cells this same process facilitates antibody production. This same channel protein, however, can also regulate functions in other cells including spermatozoa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.