EB2 (MAPRE2) (NM_001256420) Human Untagged Clone

CAT#: SC332378

MAPRE2 (untagged) - Homo sapiens microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAPRE2
• Synonyms: CSCSC2; EB1; EB2; RP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256420, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGAGAACAACAACGACATCATCCAGGATAATAACGGGACCATCATTCCTTTCCGGAAGCACACAGT
  GCGCGGGGAGCGTTCCTACAGGAGCGGCCTATTGCCAATTCATGGACATGCTCTTCCCTGGCTGCATTAG
  TTTGAAGAAAGTAAAATTTCAAGCAAAGCTGGAACATGAATATATTCACAATTTTAAACTTCTGCAAGCA
  TCATTTAAGCGAATGAACGTTGATAAGGTAATTCCAGTGGAGAAGCTAGTGAAAGGACGTTTCCAGGACA
  ACCTGGATTTTATTCAATGGTTTAAGAAATTCTATGATGCTAACTACGATGGGAAGGAGTATGATCCTGT
  AGAGGCACGACAAGGGCAAGATGCAATTCCTCCTCCTGACCCTGGTGAACAGATCTTCAACCTGCCAAAA
  AAGTCTCACCATGCAAACTCCCCCACAGCAGGTGCAGCTAAATCAAGTCCAGCAGCTAAACCAGGATCCA
  CACCTTCTCGACCCTCATCAGCCAAAAGGGCTTCTTCCAGTGGCTCAGCATCCAAATCCGATAAAGATTT
  AGAAACGCAGGTCATACAGCTTAATGAACAGGTACATTCATTAAAACTTGCCCTTGAAGGCGTGGAAAAG
  GAAAGGGATTTCTACTTTGGGAAGTTGAGAGAGATCGAGCTACTCTGCCAAGAACACGGGCAGGAAAATG
  ATGACCTCGTGCAGAGACTAATGGACATCCTGTATGCTTCAGAAGAACACGAGGGCCACACAGAAGAGCC
  GGAAGCAGAGGAGCAAGCCCACGAACAGCAGCCCCCGCAGCAGGAAGAGTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256420
• ORF Size: 825 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256420.1, NP_001243349.1
• RefSeq Size: 4151
• RefSeq ORF: 825
• Locus ID: 10982
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene shares significant homology to the adenomatous polyposis coli (APC) protein-binding EB1 gene family. This protein is a microtubule-associated protein that is necessary for spindle symmetry during mitosis. It is thought to play a role in the tumorigenesis of colorectal cancers and the proliferative control of normal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (4) lacks an alternate exon in the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.