LIMS2 (NM_001256542) Human Untagged Clone

CAT#: SC332414

LIMS2 (untagged) - Homo sapiens LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 4


  "NM_001256542" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LIMS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LIMS2
Synonyms LGMD2W; MDRCMTT; PINCH-2; PINCH2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256542, the custom clone sequence may differ by one or more nucleotides


ATGTTCAGGAGCGACGCCTACCACCCTGACCACTTCAACTGCACCCACTGTGGGAAGGAGCTGACAGCCG
AGGCCCGCGAGCTGAAGGGTGAGCTCTACTGCCTGCCCTGCCATGACAAGATGGGCGTCCCCATCTGCGG
GGCCTGCCGCCGGCCCATCGAGGGCCGAGTGGTCAACGCGCTGGGCAAGCAGTGGCACGTGGAGCACTTT
GTCTGTGCCAAGTGTGAGAAGCCATTCCTGGGGCACCGGCACTATGAGAAGAAGGGCCTGGCCTACTGCG
AGACTCACTACAACCAGCTCTTCGGGGACGTCTGCTACAACTGCAGCCATGTGATTGAAGGCGATGTGGT
GTCGGCCCTCAACAAGGCCTGGTGTGTGAGCTGCTTCTCCTGCTCCACCTGCAACAGCAAGCTCACCCTG
AAGAACAAGTTTGTGGAGTTCGACATGAAGCCCGTGTGTAAGAGGTGCTACGAGAAGTTCCCGCTGGAGC
TGAAGAAGCGGCTGAAGAAGCTGTCGGAGCTGACCTCCCGCAAGGCCCAGCCCAAGGCCACAGACCTCAA
CTCTGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256542
ORF Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256542.1, NP_001243471.1
RefSeq Size 1759
RefSeq ORF 570
Locus ID 55679
Gene Summary This gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The encoded protein has five LIM domains, each domain forming two zinc fingers, which permit interactions which regulate cell shape and migration. A pseudogene of this gene is located on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.