Retinoid X Receptor gamma (RXRG) (NM_001256571) Human Untagged Clone

CAT#: SC332421

RXRG (untagged) - Homo sapiens retinoid X receptor, gamma (RXRG), transcript variant 4


  "NM_001256571" in other vectors (2)

Reconstitution Protocol

USD 350.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "RXRG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RXRG
Synonyms NR2B3; RXRC
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256571, the custom clone sequence may differ by one or more nucleotides


ATGAACTACCCATCCACCAGCCCCGGATCTCTGGTTAAACACATCTGTGCCATCTGTGGAGACAGATCCT
CAGGAAAGCACTACGGGGTATACAGTTGTGAAGGCTGCAAAGGGTTCTTCAAGAGGACGATAAGGAAGGA
CCTCATCTACACGTGTCGGGATAATAAAGACTGCCTCATTGACAAGCGTCAGCGCAACCGCTGCCAGTAC
TGTCGCTATCAGAAGTGCCTTGTCATGGGCATGAAGAGGGAAGCTGTGCAAGAAGAAAGACAGAGGAGCC
GAGAGCGAGCTGAGAGTGAGGCAGAATGTGCTACCAGTGGTCATGAAGACATGCCTGTGGAGAGGATTCT
AGAAGCTGAACTTGCTGTTGAACCAAAGACAGAATCCTATGGTGACATGAATATGGAGAACTCGACAAAT
GACCCTGTTACCAACATATGTCATGCTGCTGACAAGCAGCTTTTCACCCTCGTTGAATGGGCCAAGCGTA
TTCCCCACTTCTCTGACCTCACCTTGGAGGACCAGGTCATTTTGCTTCGGGCAGGGTGGAATGAATTGCT
GATTGCCTCTTTCTCCCACCGCTCAGTTTCCGTGCAGGATGGCATCCTTCTGGCCACGGGTTTACATGTC
CACCGGAGCAGTGCCCACAGTGCTGGGGTCGGCTCCATCTTTGACAGAGTCCTAACTGAGCTGGTTTCCA
AAATGAAAGACATGCAGATGGACAAGTCGGAACTGGGATGCCTGCGAGCCATTGTACTCTTTAACCCAGA
TGCCAAGGGCCTGTCCAACCCCTCTGAGGTGGAGACTCTGCGAGAGAAGGTTTATGCCACCCTTGAGGCC
TACACCAAGCAGAAGTATCCGGAACAGCCAGGCAGGTTTGCCAAGCTGCTGCTGCGCCTCCCAGCTCTGC
GTTCCATTGGCTTGAAATGCCTGGAGCACCTCTTCTTCTTCAAGCTCATCGGGGACACCCCCATTGACAC
CTTCCTCATGGAGATGTTGGAGACCCCGCTGCAGATCACCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256571
ORF Size 1023 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256571.1, NP_001243500.1
RefSeq Size 1680
RefSeq ORF 1023
Locus ID 6258
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Adipocytokine signaling pathway, Non-small cell lung cancer, Pathways in cancer, PPAR signaling pathway, Small cell lung cancer, Thyroid cancer
Gene Summary This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (4) uses an alternate internal promoter, and it thus differs in the 5' UTR and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (c, also known as RXRgamma2) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode isoform c.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.