HTR2C (NM_001256761) Human Untagged Clone

CAT#: SC332469

HTR2C (untagged) - Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled (HTR2C), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HTR2C
• Synonyms: 5-HT1C; 5-HT2C; 5-HTR2C; 5HTR2C; HTR1C
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256761, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGAACCTGAGGAATGCGGTGCATTCATTCCTTGTGCACCTAATTGGCCTATTGGTTTGGCAATGTG
  ATATTTCTGTGAGCCCAGTAGCAGCTATAGTAACTGACATTTTCAATACCTCCGATGGTGGACGCTTCAA
  ATTCCCAGACGGGGTACAAAACTGGCCAGCACTTTCAATCGTCATCATAATAATCATGACAATAGGTGGC
  AACATCCTTGTGATCATGGCAGTAAGCATGGAAAAGAAACTGCACAATGCCACCAATTACTTCTTAATGT
  CCCTAGCCATTGCTGATATGCTAGTGGGACTACTTGTCATGCCCCTGTCTCTCCTGGCAATCCTTTATGA
  TTATGTCTGGCCACTACCTAGATATTTGTGCCCCGTCTGGATTTCTTTAGATGTTTTATTTTCAACAGCG
  TCCATCATGCACCTCTGCGCTATATCGCTGGATCGGTGTATCAGTTCCTATCCCTGTGATTGGACTGAGG
  GACGAAGAAAAGGTGTTCGTGAACAACACGACGTGCGTGCTCAACGACCCAAATTTCGTTCTTATTGGGT
  CCTTCGTAGCTTTCTTCATACCGCTGACGATTATGGTGATTACGTATTGCCTGACCATCTACGTTCTGCG
  CCGACAAGCTTTGATGTTACTGCACGGCCACACCGAGGAACCGCCTGGACTAAGTCTGGATTTCCTGAAG
  TGCTGCAAGAGGAATACGGCCGAGGAAGAGAACTCTGCAAACCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256761
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256761.1, NP_001243690.1
• RefSeq Size: 4679 bp
• RefSeq ORF: 747 bp
• Locus ID: 3358
• Cytogenetics: Xq23
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Calcium signaling pathway, Gap junction, Neuroactive ligand-receptor interaction
• Gene Summary: 'This gene encodes a seven-transmembrane G-protein-coupled receptor. The encoded protein responds to signaling through the neurotransmitter serotonin. The mRNA of this gene is subject to multiple RNA editing events, where adenosine residues encoded by the genome are converted to inosines. RNA editing is predicted to alter the structure of the second intracellular loop, thereby generating alternate protein forms with decreased ability to interact with G proteins. Abnormalities in RNA editing of this gene have been detected in victims of suicide that suffer from depression. In addition, naturally-occuring variation in the promoter and 5' non-coding and coding regions of this gene may show statistically-significant association with mental illness and behavioral disorders. Alternative splicing results in multiple different transcript variants. [provided by RefSeq, Jan 2015]'
  Transcript Variant: This variant (3, also known as 5-HT2C-tr) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a.