FBXW7 (NM_001257069) Human Untagged Clone

CAT#: SC332501

FBXW7 (untagged) - Homo sapiens F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase (FBXW7), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FBXW7
• Synonyms: AGO; CDC4; FBW6; FBW7; FBX30; FBXO30; FBXW6; hAgo; hCdc4; SEL-10; SEL10
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001257069, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATCAGGAACTGCTCTCTGTGGGCAGCAAAAGACGACGAACTGGAGGCTCTCTGAGAGGTAACCCTT
  CCTCAAGCCAGGTAGATGAAGAACAGATGAATCGTGTGGTAGAGGAGGAACAGCAACAGCAACTCAGACA
  ACAAGAGGAGGAGCACACTGCAAGGAATGGTGAAGTTGTTGGAGTAGAACCTAGACCTGGAGGCCAAAAT
  GATTCCCAGCAAGGACAGTTGGAAGAAAACAATAATAGATTTATTTCGGTAGATGAGGACTCCTCAGGAA
  ACCAAGAAGAACAAGAGGAAGATGAAGAACATGCTGGTGAACAAGATGAGGAGGATGAGGAGGAGGAGGA
  GATGGACCAGGAGAGTGACGATTTTGATCAGTCTGATGATAGTAGCAGAGAAGATGAACATACACATACT
  AACAGTGTCACGAACTCCAGTAGTATTGTGGACCTGCCCGTTCACCAACTCTCCTCCCCATTCTATACAA
  AAACAACAAAAGTGAGTATATTCAATATATTGTTAACCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001257069
• ORF Size: 531 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001257069.1, NP_001243998.1
• RefSeq Size: 989
• RefSeq ORF: 531
• Locus ID: 55294
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
  Transcript Variant: This variant (4) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform 4 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.