Beta Arrestin 2 (ARRB2) (NM_001257328) Human Untagged Clone

CAT#: SC332525

ARRB2 (untagged) - Homo sapiens arrestin, beta 2 (ARRB2), transcript variant 3


  "NM_001257328" in other vectors (2)

Reconstitution Protocol

USD 430.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARRB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARRB2
Synonyms ARB2; ARR2; BARR2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001257328, the custom clone sequence may differ by one or more nucleotides


ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACCGTGTACTTGG
GCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGCGTGGTGCTTGTGGACCCTGA
CTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGCGCCTTCCGCTATGGCCGTGAAGACCTGGAT
GTGCTGGGCTTGTCCTTCCGCAAAGACCTGTTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACC
CACCCCGGCCCCCCACCCGCCTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTT
CTTCACCGTGAGGATGCCCCTGCCCTCTGAGGGCCAGGGGGCTGGGGCTGGGACTGTGTCTGGGGTGGGG
ATACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAGGCCTGCGGCG
TAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGCCACAAAAGGAACTCTGTGCG
GCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCCGGCCCCCAGCCTTCAGCCGAAACCACACGC
CACTTCCTCATGTCTGACCGGTCCCTGCACCTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGG
AGCCCCTCAATGTAAATGTCCACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGT
GAGACAGTACGCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTCAGCGACAACC
GGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACCAACCTGGCTTCCAGCACCAT
CGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTGGTGTCCTACAGGGTCAAGGTGAAGCTGGTG
GTGTCTCGAGGCGGGGATGTCTCTGTGGAGCTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACA
TCCCCCTCCCCAGACCCCAGTCAGCCGCTCCGGAGACAGATGTCCCTGTGGACACCAACCTCATTGAATT
TGATACCAACTATGCCACAGATGATGACATTGTGTTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATG
AAGGATGACGACTATGATGATCAACTCTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001257328
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257328.1, NP_001244257.1
RefSeq Size 1999 bp
RefSeq ORF 1293 bp
Locus ID 409
Cytogenetics 17p13.2
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway, Endocytosis, MAPK signaling pathway, Olfactory transduction
Gene Summary 'Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]'
Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.