Chk2 (CHEK2) (NM_001257387) Human Untagged Clone
CAT#: SC332541
CHEK2 (untagged) - Homo sapiens checkpoint kinase 2 (CHEK2), transcript variant 4
"NM_001257387" in other vectors (2)
Product Images
Other products for "CHEK2"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CHEK2 |
| Synonyms | CDS1; CHK2; hCds1; HuCds1; LFS2; PP1425; RAD53 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001257387, the custom clone sequence may differ by one or more nucleotides
ATGTCAAAAACTCTTGGAAGTGGTGCCTGTGGAGAGGTAAAGCTGGCTTTCGAGAGGAAAACATGTAAGA AAGTAGCCATAAAGATCATCAGCAAAAGGAAGTTTGCTATTGGTTCAGCAAGAGAGGCAGACCCAGCTCT CAATGTTGAAACAGAAATAGAAATTTTGAAAAAGCTAAATCATCCTTGCATCATCAAGATTAAAAACTTT TTTGATGCAGAAGATTATTATATTGTTTTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTGGTGG GGAATAAACGCCTGAAAGAAGCTACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAGTACCT TCATGAAAACGGTATTATACACCGTGACTTAAAGCCAGAGAATGTTTTACTGTCATCTCAAGAAGAGGAC TGTCTTATAAAGATTACTGATTTTGGGCACTCCAAGATTTTGGGAGAGACCTCTCTCATGAGAACCTTAT GTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTTTCTGTTGGGACTGCTGGGTATAACCGTGCTGT GGACTGCTGGAGTTTAGGAGTTATTCTTTTTATCTGCCTTAGTGGGTATCCACCTTTCTCTGAGCATAGG ACTCAAGTGTCACTGAAGGATCAGATCACCAGTGGAAAATACAACTTCATTCCTGAAGTCTGGGCAGAAG TCTCAGAGAAAGCTCTGGACCTTGTCAAGAAGTTGTTGGTAGTGGATCCAAAGGCACGTTTTACGACAGA AGAAGCCTTAAGACACCCGTGGCTTCAGGATGAAGACATGAAGAGAAAGTTTCAAGATCTTCTGTCTGAG GAAAATGAATCCACAGCTCTACCCCAGGTTCTAGCCCAGCCTTCTACTAGTCGAAAGCGGCCCCGTGAAG GGGAAGCCGAGGGTGCCGAGACCACAAAGCGCCCAGCTGTGTGTGCTGCTGTGTTGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001257387 |
| ORF Size | 969 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001257387.1, NP_001244316.1 |
| RefSeq Size | 1976 |
| RefSeq ORF | 969 |
| Locus ID | 11200 |
| Protein Families | Druggable Genome, Protein Kinase, Stem cell - Pluripotency |
| Protein Pathways | Cell cycle, p53 signaling pathway |
| Gene Summary | In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (4) contains an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (d) is shorter at the N-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China