Radixin (RDX) (NM_001260494) Human Untagged Clone

CAT#: SC332739

RDX (untagged) - Homo sapiens radixin (RDX), transcript variant 4


  "NM_001260494" in other vectors (2)

Reconstitution Protocol

USD 450.00

5 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RDX
Synonyms DFNB24
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001260494, the custom clone sequence may differ by one or more nucleotides


ATGCTGAGCTGGAATTTGCCATTCAGCCCAATACAACTGGCAAACAACTTTTTGACCAGTGTATTGGAAC
AACACAAACTAACAAAAGAACAGTGGGAAGAAAGAATACAGAACTGGCATGAAGAACATAGAGGAATGTT
AAGGGAGGATTCTATGATGGAATACCTGAAGATTGCACAAGATCTAGAAATGTATGGAGTCAACTATTTT
GAAATAAAAAATAAAAAAGGAACTGAATTGTGGCTAGGTGTTGATGCTTTGGGTCTGAATATTTATGAGC
ATGACGACAAGTTAACACCTAAAATTGGTTTTCCCTGGAGTGAAATCAGAAATATTTCATTTAATGACAA
AAAATTTGTTATAAAGCCAATCGACAAAAAGGCACCTGATTTTGTGTTTTATGCACCTCGTCTGAGAATC
AATAAGCGGATTTTGGCCTTATGTATGGGAAACCATGAACTATACATGCGAAGAAGGAAGCCTGATACTA
TTGAAGTACAACAGATGAAGGCTCAGGCTAGGGAGGAGAAACATCAGAAGCAGTTGGAAAGGGCACAATT
AGAGAATGAAAAGAAGAAAAGAGAAATAGCAGAAAAGGAAAAGGAAAGAATAGAACGTGAAAAGGAAGAG
CTAATGGAACGTCTAAAACAAATTGAAGAGCAGACAATTAAAGCTCAGAAAGAACTAGAAGAACAGACTC
GAAAAGCTCTAGAACTGGATCAAGAACGAAAACGAGCAAAAGAAGAAGCAGAACGACTTGAAAAGGAGCG
TCGAGCTGCTGAAGAGGCAAAGTCTGCCATAGCAAAACAAGCTGCCGACCAGATGAAGAATCAGGAGCAG
CTAGCAGCAGAACTTGCTGAATTCACTGCCAAGATTGCACTTCTAGAGGAAGCCAAGAAGAAAAAGGAAG
AGGAAGCTACTGAGTGGCAACACAAAGCTTTTGCAGCCCAGGAAGACTTGGAAAAGACCAAAGAAGAGTT
AAAAACTGTGATGTCTGCCCCCCCTCCACCTCCACCACCACCAGTCATTCCTCCAACAGAAAACGAACAT
GATGAACACGATGAGAATAATGCTGAAGCTAGTGCTGAATTATCAAATGAAGGGGTAATGAACCATAGAA
GCGAGGAAGAACGTGTAACCGAAACACAGAAAAATGAGCGTGTTAAGAAGCAACTTCAGGCATTAAGTTC
AGAATTAGCCCAAGCCAGAGATGAAACCAAGAAAACACAAAATGATGTTCTTCATGCTGAGAATGTTAAA
GCAGGCCGTGATAAGTACAAGACTCTGCGACAGATTCGACAAGGCAATACAAAGCAGCGTATCGATGAGT
TTGAAGCAATGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001260494
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001260494.1, NP_001247423.1
RefSeq Size 4123 bp
RefSeq ORF 1344 bp
Locus ID 5962
Cytogenetics 11q22.3
Protein Families Druggable Genome
Protein Pathways Regulation of actin cytoskeleton
Gene Summary 'Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]'
Transcript Variant: This variant (4) lacks two internal coding exons and differs in the 3' region, compared to variant 1. The resulting isoform (3) lacks an internal segment and has a shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.