Radixin (RDX) (NM_001260496) Human Untagged Clone
CAT#: SC332741
RDX (untagged) - Homo sapiens radixin (RDX), transcript variant 6
"NM_001260496" in other vectors (2)
Product Images
Other products for "RDX"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RDX |
Synonyms | DFNB24 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001260496, the custom clone sequence may differ by one or more nucleotides
ATGCCGAAACCAATCAACGTAAGAGTAACTACAATGGATGCTGAGCTGGAATTTGCCATTCAGCCCAATA CAACTGGCAAACAACTTTTTGACCAGGTAACACAGCAGGATGTTAAAAAAGAGAATCCTTTACAGTTCAA GTTTAGAGCTAAATTCTTTCCTGAAGATGTTTCTGAGGAATTAATTCAAGAAATAACCCAGAGACTCTTC TTCTTGCAAGTTAAAGAAGCCATCTTAAATGATGAGATATATTGCCCGCCAGAAACTGCAGTTCTTTTGG CTTCCTATGCTGTCCAAGCCAAGTATGGAGATTACAATAAAGAGATTCATAAGCCAGGCTACCTGGCTAA TGATAGACTCCTACCCCAGCGTGTATTGGAACAACACAAACTAACAAAAGAACAAGATGAAACCAAGAAA ACACAAAATGATGTTCTTCATGCTGAGAATGTTAAAGCAGGCCGTGATAAGTACAAGACTCTGCGACAGA TTCGACAAGGCAATACAAAGCAGCGTATCGATGAGTTTGAAGCAATGTGGGGACCCAAACTGTATGCATT GTTCCAGATGCGCTCTTGCCAAAGCAGCATAAAGCAAATGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001260496 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001260496.1, NP_001247425.1 |
RefSeq Size | 1549 bp |
RefSeq ORF | 603 bp |
Locus ID | 5962 |
Cytogenetics | 11q22.3 |
Protein Families | Druggable Genome |
Protein Pathways | Regulation of actin cytoskeleton |
Gene Summary | 'Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]' Transcript Variant: This variant (6) lacks multiple exons in the coding region, compared to variant 1. The resulting isoform (5) lacks two internal segments, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.