GIRK1 (KCNJ3) (NM_001260510) Human Untagged Clone
CAT#: SC332750
KCNJ3 (untagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 3 (KCNJ3), transcript variant 4
"NM_001260510" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNJ3 |
Synonyms | GIRK1; KGA; KIR3.1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001260510, the custom clone sequence may differ by one or more nucleotides
ATGTCTGCACTCCGAAGGAAATTTGGGGACGATTATCAGGTAGTGACCACATCGTCCAGCGGCTCGGGCT TGCAGCCCCAGGGGCCAGGCCAGGACCCTCAGCAGCAGCTTGTGCCCAAGAAGAAGCGGCAGCGGTTCGT GGACAAGAACGGCCGGTGCAATGTACAGCACGGCAACCTGGGCAGCGAGACAAGCCGCTACCTCTCGGAC CTCTTCACCACGCTGGTGGACCTCAAGTGGCGCTGGAACCTCTTCATCTTCATTCTCACCTACACCGTGG CCTGGCTTTTCATGGCGTCCATGTGGTGGGTGATCGCCTACACTCGGGGCGACCTGAACAAAGCCCACGT CGGTAACTACACGCCTTGCGTGGCCAATGTCTATAACTTCCCTTCTGCCTTCCTCTTCTTCATCGAGACG GAGGCCACCATCGGCTATGGCTACCGATACATCACAGACAAGTGCCCCGAGGGCATCATCCTCTTCCTCT TCCAGTCCATCCTGGGCTCCATCGTGGACGCCTTCCTCATCGGCTGCATGTTCATCAAGATGTCCCAGCC CAAGAAGCGCGCCGAGACCCTCATGTTCAGCGAGCACGCGGTGATCTCCATGAGGGACGGAAAACTCACG CTTATGTTCCGGGTGGGCAACCTGCGCAACAGCCACATGGTCTCCGCGCAGATTCGCTGCAAGCTGCTCA AAGTAAGTGCTCCCCGCCCCTTCCCCACCGGGAGACCTGCGTCCCCCAAACCCGCGGAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001260510 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001260510.1, NP_001247439.1 |
RefSeq Size | 1011 bp |
RefSeq ORF | 762 bp |
Locus ID | 3760 |
Cytogenetics | 2q24.1 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | 'Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]' Transcript Variant: This variant (4) lacks multiple 3' terminal exons and contains an additional coding segment, compared to variant 1. These differences result in a protein (isoform 4; also known as GIRK1e) with a truncated and novel C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233555 | KCNJ3 (Myc-DDK tagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 3 (KCNJ3), transcript variant 4 |
USD 420.00 |
|
RG233555 | KCNJ3 (GFP-tagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 3 (KCNJ3), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review