PPP1R1C (NM_001261424) Human Untagged Clone

CAT#: SC332773

PPP1R1C (untagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP1R1C
• Synonyms: IPP5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001261424, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCCAACAGTCCCAAAAAGATACAGTTTGCCGTGCCTGTATTCCAGAGTCAGATTGCACCTGAAG
  CAGCAGAGCAGCTGGGCTTTTGTCGTTCACAGATCAGGAAAAGAAGACCTACACCAGCATCACTTGTGAT
  TCTCAATGAGCATAACCCCCCAGAAATAGATGACAAGAGGGGGCCCAACACACAAGGGGAATTACAGAAT
  GCATCCCCTAAGCAAAGGAAGCAGAGTGTGTACACACCACCCACCATAAAAGGGGTTAAGCATCTGAAAG
  GCCAGAATGAATCAGCATTCCCTGAAGAAGAAGAAGGCACCAATGAAAGAGAGGAGCAGCGGGACCATTA
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001261424
• ORF Size: 351 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001261424.1, NP_001248353.1
• RefSeq Size: 3053
• RefSeq ORF: 351
• Locus ID: 151242
• Protein Families: Druggable Genome, Phosphatase
• Gene Summary: Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]). [supplied by OMIM, Feb 2010]
  Transcript Variant: This variant (1) encodes the longest protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.