RTN3 (NM_001265591) Human Untagged Clone
CAT#: SC332812
RTN3 (untagged) - Homo sapiens reticulon 3 (RTN3), transcript variant 7
"NM_001265591" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "RTN3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RTN3 |
Synonyms | ASYIP; HAP; NSPL2; NSPLII; RTN3-A1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001265591, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGCCGTCGGCGGCCACTCAGTCCCATTCCATCTCCTCGTCGTCCTTCGGAGCCGAGCCGTCCG CGCCCGGCGGCGGCGGGAGCCCAGGAGCCTGCCCCGCCCTGGGGACGAAGAGCTGCAGCTCCTCCTGTGC GGTGCACGATCTGATTTTCTGGAGAGATGTGAAGAAGACTGGGTTTGTCTTTGGCACCACGCTGATCATG CTGCTTTCCCTGGCAGCTTTCAGTGTCATCAGTGTGGTTTCTTACCTCATCCTGGCTCTTCTCTCTGTCA CCATCAGCTTCAGGATCTACAAGTCCGTCATCCAAGCTGTACAGAAGTCAGAAGAAGGCCATCCATTCAA ACCCAGATTGATCACTATGTTGGCATCGCCCGAGATCAGACCAAGTCAATTGTTGAAAAGATCCAAGCAA AACTCCCTGGAATCGCCAAAAAAAAGGCAGAATAAGTACATGGAAACCAGAAATGCAACAGTTACTAAAA CACCATTTAATAGTTATAACGTCGTTACTTGTACTATGAAGGAAAATACTCAGTGTCAGCTTGAGCCTGC ATTCCAAGCTTTTTTTTTAATTTGGTGTTTTCTCCCATCCTTTCCCTTTAACCCTCAGTATCAAGCACAA AAATTGATGGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001265591 |
ORF Size | 645 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001265591.1, NP_001252520.1 |
RefSeq Size | 2332 |
RefSeq ORF | 645 |
Locus ID | 10313 |
Protein Families | Transmembrane |
Gene Summary | This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012] Transcript Variant: This variant (7) lacks three consecutive exons in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (g) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.