ING1 (NM_001267728) Human Untagged Clone

CAT#: SC332877

ING1 (untagged) - Homo sapiens inhibitor of growth family, member 1 (ING1), transcript variant 5


  "NM_001267728" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ING1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ING1
Synonyms p24ING1c; p33; p33ING1; p33ING1b; p47; p47ING1a
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001267728, the custom clone sequence may differ by one or more nucleotides


ATGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGC
CTAGCGCAATAACTGAGATCCTGAAGGAGCTAGACGAGTGCTACGAGCGCTTCAGTCGCGAGACAGACGG
GGCGCAGAAGCGGCGGATGCTGCACTGTGTGCAGCGCGCGCTGATCCGCAGCCAGGAGCTGGGCGACGAG
AAGATCCAGATCGTGAGCCAGATGGTGGAGCTGGTGGAGAACCGCACGCGGCAGGTGGACAGCCACGTGG
AGCTGTTCGAGGCGCAGCAGGAGCTGGGCGACACAGCGGGCAACAGCGGCAAGGCTGGCGCGGACAGGCC
CAAAGGCGAGGCGGCAGCGCAGGCTGACAAGCCCAACAGCAAGCGCTCACGGCGGCAGCGCAACAACGAG
AACCGTGAGAACGCGTCCAGCAACCACGACCACGACGACGGCGCCTCGGGCACACCCAAGGAGAAGAAGG
CCAAGACCTCCAAGAAGAAGAAGCGCTCCAAGGCCAAGGCGGAGCGAGAGGCGTCCCCTGCCGACCTCCC
CATCGACCCCAACGAACCCACGTACTGTCTGTGCAACCAGGTCTCCTATGGGGAGATGATCGGCTGCGAC
AACGACGAGTGCCCCATCGAGTGGTTCCACTTCTCGTGCGTGGGGCTCAATCATAAACCCAAGGGCAAGT
GGTACTGTCCCAAGTGCCGGGGGGAGAACGAGAAGACCATGGACAAAGCCCTGGAGAAATCCAAAAAAGA
GAGGGCTTACAACAGGTAG


Restriction Sites SgfI-RsrII     
ACCN NM_001267728
ORF Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001267728.1, NP_001254657.1
RefSeq Size 1956
RefSeq ORF 789
Locus ID 3621
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) lacks an internal segment in the 5' coding region, compared to variant 4. The resulting isoform (E) lacks an internal segment, as compared to isoform D.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.