ILF2 (NM_001267809) Human Untagged Clone

CAT#: SC332881

ILF2 (untagged) - Homo sapiens interleukin enhancer binding factor 2 (ILF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ILF2
• Synonyms: NF45; PRO3063
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267809, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCTTTCCCCGGGTCAAGCCAGCACCTGATGAAACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAATC
  AGGACCTGGCTCCCAATTCTGCTGAACAGGCATCTATCCTTTCTCTGGTGACAAAAATAAACAATGTGAT
  TGATAATCTGATTGTGGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCCTAT
  AAAAAGGGGACAATGACTACAGGACACAATGTGGCTGACCTGGTGGTGATACTCAAGATTCTGCCAACGT
  TGGAAGCTGTTGCTGCCCTGGGGAACAAAGTCGTGGAAAGCCTAAGAGCACAGGATCCTTCTGAAGTTTT
  AACCATGCTGACCAACGAAACTGGCTTTGAAATCAGTTCTTCTGATGCTACAGTGAAGATTCTCATTACA
  ACAGTGCCACCCAATCTTCGAAAACTGGATCCAGAACTCCATTTGGATATCAAAGTATTGCAGAGTGCCT
  TAGCAGCCATCCGACATGCCCGCTGGTTCGAGGAAAATGCTTCTCAGTCCACAGTTAAAGTTCTCATCAG
  ACTACTGAAGGACTTGAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTTGACCTACTA
  GGCCATTATGCTGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTTGCATACAGGCGCTGCT
  TGCAGATTCTGGCTGCAGGACTGTTCCTGCCAGGTTCAGTGGGTATCACTGACCCCTGTGAGAGTGGCAA
  CTTTAGAGTACACACAGTCATGACCCTAGAACAGCAGGACATGGTCTGCTATACAGCTCAGACTCTCGTC
  CGAATCCTCTCACATGGTGGCTTTAGGAAGATCCTTGGCCAGGAGGGTGATGCCAGCTATCTTGCTTCTG
  AAATATCTACCTGGGATGGAGTGATAGTAACACCTTCAGAAAAGGCTTATGAGAAGCCACCAGAGAAGAA
  GGAAGGAGAGGAAGAAGAGGAGAATACAGAAGAACCACCTCAAGGAGAGGAAGAAGAAAGCATGGAAACT
  CAGGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267809
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001267809.1, NP_001254738.1
• RefSeq Size: 1953 bp
• RefSeq ORF: 1059 bp
• Locus ID: 3608
• Cytogenetics: 1q21.3
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14. [provided by RefSeq, Dec 2014]'
  Transcript Variant: This variant (2) uses an alternate splice site in its 5' UTR and uses an in-frame downstream start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1.