HSD11B1L (NM_001267869) Human Untagged Clone

CAT#: SC332888

HSD11B1L (untagged) - Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant j

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HSD11B1L
• Synonyms: 11-beta-HSD3; 11-DH3; HSD1L; HSD3; SCDR10; SCDR10B; SDR26C2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267869, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGGTAAACTTTGTGAGCTACGTGCAACTGACGTCGCGGGCGCTGCCCAGCCTGACGGACAGCAAGG
  GCTCCCTGGTGGTGGTGTCCTCGCTGCTCGGCCGCGTGCCCACGTCGTTCTCCACTCCCTACTCGGCGGC
  CAAGTTTGCGCTGGACGGCTTCTTCGGCTCCCTGCGGCGGGAGCTGGACGTGCAGGACGTGAACGTGGCC
  ATCACCATGTGCGTCCTGGGCCTCCGAGATCGCGCCTCCGCCGCCGAGGCAGTCAGGGGAGTCACGAGGG
  TCAAGGCGGCCCCGGGGCCCAAGGCAGCCCTGGCCGTGATCCGCGGCGGCGCCACGCGCGCGGCCGGCGT
  CTTCTACCCGTGGCGTTTCCGCCTGCTGTGCTTGCTCCGGCGCTGGCTACCGCGCCCGCGGGCCTGGTTT
  ATCCGCCAGGAGCTCAACGTCACGGCCGCGGCAGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267869
• ORF Size: 459 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001267869.1, NP_001254798.1
• RefSeq Size: 1785
• RefSeq ORF: 459
• Locus ID: 374875
• Protein Families: Druggable Genome
• Gene Summary: This gene is a member of the hydroxysteroid dehydrogenase family. The encoded protein is similar to an enzyme that catalyzes the interconversion of inactive to active glucocorticoids (e.g. cortisone). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
  Transcript Variant: This variant (j) has multiple differences in the coding region, and initiates translation at an alternate downstream in-frame start codon, compared to variant g. The encoded isoform (d) is shorter than isoform g. Variants d and j encode the same protein.