HSD11B1L (NM_001267870) Human Untagged Clone

CAT#: SC332889

HSD11B1L (untagged) - Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant h

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HSD11B1L
• Synonyms: 11-beta-HSD3; 11-DH3; HSD1L; HSD3; SCDR10; SCDR10B; SDR26C2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267870, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGTGCTTCTCCTCACAGGGCTGGGGGCCCTGTTCTTCGCCTATTATTGGGATGACAACTTCGACC
  CAGGTAAACTTTGTGAGCTACGTGCAACTGACGTCGCGGGCGCTGCCCAGCCTGACGGACAGCAAGGGCT
  CCCTGGTGGTGGTGTCCTCGCTGCTCGGCCGCGTGCCCACGTCGTTCTCCACTCCCTACTCGGCGGCCAA
  GTTTGCGCTGGACGGCTTCTTCGGCTCCCTGCGGCGGGAGCTGGACGTGCAGGACGTGAACGTGGCCATC
  ACCATGTGCGTCCTGGGCCTCCGAGATCGCGCCTCCGCCGCCGAGGCAGTCAGGGGAGTCACGAGGGTCA
  AGGCGGCCCCGGGGCCCAAGGCAGCCCTGGCCGTGATCCGCGGCGGCGCCACGCGCGCGGCCGGCGTCTT
  CTACCCGTGGCGTTTCCGCCTGCTGTGCTTGCTCCGGCGCTGGCTACCGCGCCCGCGGGCCTGGTTTATC
  CGCCAGGAGCTCAACGTCACGGCCGCGGCAGCCTGAGCACCGGGGGGTGCCCCTCCAGTCCCAGACGGCA
  ATGTTCCTCCCTCCAACTGTCCCTGGAGCCAGAACACTCACAGAGACACCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267870
• ORF Size: 615 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001267870.1, NP_001254799.1
• RefSeq Size: 1625
• RefSeq ORF: 615
• Locus ID: 374875
• Protein Families: Druggable Genome
• Gene Summary: This gene is a member of the hydroxysteroid dehydrogenase family. The encoded protein is similar to an enzyme that catalyzes the interconversion of inactive to active glucocorticoids (e.g. cortisone). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
  Transcript Variant: This variant (h) has multiple differences in the coding region, one of which results in initiation of translation at a downstream in-frame start codon, compared to variant g. An additional difference results in a frameshift. The encoded protein (isoform h) has a distinct C-terminus and is shorter than isoform g.